\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0335708563:

Variant ID: vg0335708563 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 35708563
Reference Allele: TAlternative Allele: A
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.92, A: 0.09, others allele: 0.00, population size: 63. )

Flanking Sequence (100 bp) in Reference Genome:


AATGACCCTCCGATGGGATGGGTCATACCTACCTCCACTCCACCGGAAGCAGATGCAACGTGGGAGCACGGTTGTCTGCCGATGACGTGACCGGCGTCAG[T/A]
CCAGTCACTGACCGGTCATTCTTCTCCACCACGCGTCAGTTTAGCATGCCGCACATCTGCTCTTCTTCATACAGTGACTTCCTTGCAATGGTTGCGATGA

Reverse complement sequence

TCATCGCAACCATTGCAAGGAAGTCACTGTATGAAGAAGAGCAGATGTGCGGCATGCTAAACTGACGCGTGGTGGAGAAGAATGACCGGTCAGTGACTGG[A/T]
CTGACGCCGGTCACGTCATCGGCAGACAACCGTGCTCCCACGTTGCATCTGCTTCCGGTGGAGTGGAGGTAGGTATGACCCATCCCATCGGAGGGTCATT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 62.00% 18.40% 5.73% 13.86% NA
All Indica  2759 92.30% 2.20% 4.78% 0.69% NA
All Japonica  1512 4.90% 52.00% 1.98% 41.14% NA
Aus  269 64.30% 0.40% 35.32% 0.00% NA
Indica I  595 92.60% 3.00% 3.03% 1.34% NA
Indica II  465 91.20% 4.70% 4.09% 0.00% NA
Indica III  913 92.90% 0.40% 6.46% 0.22% NA
Indica Intermediate  786 92.10% 2.20% 4.58% 1.15% NA
Temperate Japonica  767 0.80% 86.70% 1.17% 11.34% NA
Tropical Japonica  504 10.30% 6.30% 3.77% 79.56% NA
Japonica Intermediate  241 6.60% 36.90% 0.83% 55.60% NA
VI/Aromatic  96 80.20% 3.10% 8.33% 8.33% NA
Intermediate  90 64.40% 22.20% 6.67% 6.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0335708563 T -> A LOC_Os03g63190.1 upstream_gene_variant ; 864.0bp to feature; MODIFIER silent_mutation Average:77.871; most accessible tissue: Zhenshan97 flag leaf, score: 91.425 N N N N
vg0335708563 T -> A LOC_Os03g63160.1 downstream_gene_variant ; 4499.0bp to feature; MODIFIER silent_mutation Average:77.871; most accessible tissue: Zhenshan97 flag leaf, score: 91.425 N N N N
vg0335708563 T -> A LOC_Os03g63170.1 downstream_gene_variant ; 1555.0bp to feature; MODIFIER silent_mutation Average:77.871; most accessible tissue: Zhenshan97 flag leaf, score: 91.425 N N N N
vg0335708563 T -> A LOC_Os03g63200.1 downstream_gene_variant ; 1741.0bp to feature; MODIFIER silent_mutation Average:77.871; most accessible tissue: Zhenshan97 flag leaf, score: 91.425 N N N N
vg0335708563 T -> A LOC_Os03g63170-LOC_Os03g63190 intergenic_region ; MODIFIER silent_mutation Average:77.871; most accessible tissue: Zhenshan97 flag leaf, score: 91.425 N N N N
vg0335708563 T -> DEL N N silent_mutation Average:77.871; most accessible tissue: Zhenshan97 flag leaf, score: 91.425 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0335708563 T A -0.01 -0.01 -0.01 -0.01 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0335708563 NA 3.62E-12 mr1182 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335708563 NA 5.07E-07 mr1190 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335708563 NA 3.82E-10 mr1282 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335708563 NA 4.19E-06 mr1569 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335708563 NA 2.70E-07 mr1606 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335708563 NA 3.50E-06 mr1606 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335708563 NA 9.95E-12 mr1650 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335708563 NA 7.46E-10 mr1658 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335708563 NA 1.18E-06 mr1013_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335708563 NA 3.56E-11 mr1611_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335708563 NA 7.18E-06 mr1840_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251