Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0335708031:

Variant ID: vg0335708031 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 35708031
Reference Allele: A	Alternative Allele: T
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ATGTTCGCGAGAGAGGTAATGCACAAGACACGGGCGATGTAGACAGGTTCGGGCCGCTGAGAAGCGTAATACCCTACTCCTGTGTTCTGGTGGATCTGTG[A/T]
GTGAAGGAGTTACAAAGAGCTGGAGAGGAAGAGAGTTCAAGCTCTAGAAACCCTCTTCCTTTGTCTCTCCTCTACAAGCTCAGATGTTCTCTCAGTTCTA

Reverse complement sequence

TAGAACTGAGAGAACATCTGAGCTTGTAGAGGAGAGACAAAGGAAGAGGGTTTCTAGAGCTTGAACTCTCTTCCTCTCCAGCTCTTTGTAACTCCTTCAC[T/A]
CACAGATCCACCAGAACACAGGAGTAGGGTATTACGCTTCTCAGCGGCCCGAACCTGTCTACATCGCCCGTGTCTTGTGCATTACCTCTCTCGCGAACAT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	68.70%	18.00%	0.99%	12.38%	NA
All Indica	2759	97.50%	1.70%	0.25%	0.51%	NA
All Japonica	1512	8.50%	51.90%	2.58%	37.04%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	96.30%	2.40%	0.50%	0.84%	NA
Indica II	465	95.50%	4.10%	0.22%	0.22%	NA
Indica III	913	99.30%	0.30%	0.00%	0.33%	NA
Indica Intermediate	786	97.50%	1.50%	0.38%	0.64%	NA
Temperate Japonica	767	2.30%	86.30%	0.65%	10.69%	NA
Tropical Japonica	504	16.30%	6.70%	5.56%	71.43%	NA
Japonica Intermediate	241	12.00%	36.50%	2.49%	48.96%	NA
VI/Aromatic	96	94.80%	1.00%	0.00%	4.17%	NA
Intermediate	90	73.30%	17.80%	1.11%	7.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0335708031	A -> T	LOC_Os03g63190.1	upstream_gene_variant ; 1396.0bp to feature; MODIFIER	silent_mutation	Average:73.564; most accessible tissue: Zhenshan97 flag leaf, score: 84.864	N	N	N	N
vg0335708031	A -> T	LOC_Os03g63160.1	downstream_gene_variant ; 3967.0bp to feature; MODIFIER	silent_mutation	Average:73.564; most accessible tissue: Zhenshan97 flag leaf, score: 84.864	N	N	N	N
vg0335708031	A -> T	LOC_Os03g63170.1	downstream_gene_variant ; 1023.0bp to feature; MODIFIER	silent_mutation	Average:73.564; most accessible tissue: Zhenshan97 flag leaf, score: 84.864	N	N	N	N
vg0335708031	A -> T	LOC_Os03g63200.1	downstream_gene_variant ; 2273.0bp to feature; MODIFIER	silent_mutation	Average:73.564; most accessible tissue: Zhenshan97 flag leaf, score: 84.864	N	N	N	N
vg0335708031	A -> T	LOC_Os03g63170-LOC_Os03g63190	intergenic_region ; MODIFIER	silent_mutation	Average:73.564; most accessible tissue: Zhenshan97 flag leaf, score: 84.864	N	N	N	N
vg0335708031	A -> DEL	N	N	silent_mutation	Average:73.564; most accessible tissue: Zhenshan97 flag leaf, score: 84.864	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0335708031	NA	7.13E-31	mr1137	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335708031	NA	1.78E-28	mr1617	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335708031	NA	9.13E-06	mr1657	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335708031	NA	8.31E-21	mr1010_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335708031	NA	2.60E-15	mr1013_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335708031	NA	1.12E-25	mr1115_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335708031	NA	3.22E-38	mr1137_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335708031	NA	1.08E-07	mr1137_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335708031	3.71E-06	3.71E-06	mr1147_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335708031	NA	8.90E-08	mr1521_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335708031	NA	8.52E-06	mr1596_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335708031	NA	3.13E-24	mr1611_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335708031	NA	7.44E-12	mr1611_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335708031	NA	9.34E-29	mr1617_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335708031	NA	6.03E-06	mr1617_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335708031	NA	1.31E-06	mr1851_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251