\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0335708031:

Variant ID: vg0335708031 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 35708031
Reference Allele: AAlternative Allele: T
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATGTTCGCGAGAGAGGTAATGCACAAGACACGGGCGATGTAGACAGGTTCGGGCCGCTGAGAAGCGTAATACCCTACTCCTGTGTTCTGGTGGATCTGTG[A/T]
GTGAAGGAGTTACAAAGAGCTGGAGAGGAAGAGAGTTCAAGCTCTAGAAACCCTCTTCCTTTGTCTCTCCTCTACAAGCTCAGATGTTCTCTCAGTTCTA

Reverse complement sequence

TAGAACTGAGAGAACATCTGAGCTTGTAGAGGAGAGACAAAGGAAGAGGGTTTCTAGAGCTTGAACTCTCTTCCTCTCCAGCTCTTTGTAACTCCTTCAC[T/A]
CACAGATCCACCAGAACACAGGAGTAGGGTATTACGCTTCTCAGCGGCCCGAACCTGTCTACATCGCCCGTGTCTTGTGCATTACCTCTCTCGCGAACAT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 68.70% 18.00% 0.99% 12.38% NA
All Indica  2759 97.50% 1.70% 0.25% 0.51% NA
All Japonica  1512 8.50% 51.90% 2.58% 37.04% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 96.30% 2.40% 0.50% 0.84% NA
Indica II  465 95.50% 4.10% 0.22% 0.22% NA
Indica III  913 99.30% 0.30% 0.00% 0.33% NA
Indica Intermediate  786 97.50% 1.50% 0.38% 0.64% NA
Temperate Japonica  767 2.30% 86.30% 0.65% 10.69% NA
Tropical Japonica  504 16.30% 6.70% 5.56% 71.43% NA
Japonica Intermediate  241 12.00% 36.50% 2.49% 48.96% NA
VI/Aromatic  96 94.80% 1.00% 0.00% 4.17% NA
Intermediate  90 73.30% 17.80% 1.11% 7.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0335708031 A -> T LOC_Os03g63190.1 upstream_gene_variant ; 1396.0bp to feature; MODIFIER silent_mutation Average:73.564; most accessible tissue: Zhenshan97 flag leaf, score: 84.864 N N N N
vg0335708031 A -> T LOC_Os03g63160.1 downstream_gene_variant ; 3967.0bp to feature; MODIFIER silent_mutation Average:73.564; most accessible tissue: Zhenshan97 flag leaf, score: 84.864 N N N N
vg0335708031 A -> T LOC_Os03g63170.1 downstream_gene_variant ; 1023.0bp to feature; MODIFIER silent_mutation Average:73.564; most accessible tissue: Zhenshan97 flag leaf, score: 84.864 N N N N
vg0335708031 A -> T LOC_Os03g63200.1 downstream_gene_variant ; 2273.0bp to feature; MODIFIER silent_mutation Average:73.564; most accessible tissue: Zhenshan97 flag leaf, score: 84.864 N N N N
vg0335708031 A -> T LOC_Os03g63170-LOC_Os03g63190 intergenic_region ; MODIFIER silent_mutation Average:73.564; most accessible tissue: Zhenshan97 flag leaf, score: 84.864 N N N N
vg0335708031 A -> DEL N N silent_mutation Average:73.564; most accessible tissue: Zhenshan97 flag leaf, score: 84.864 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0335708031 NA 7.13E-31 mr1137 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335708031 NA 1.78E-28 mr1617 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335708031 NA 9.13E-06 mr1657 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335708031 NA 8.31E-21 mr1010_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335708031 NA 2.60E-15 mr1013_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335708031 NA 1.12E-25 mr1115_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335708031 NA 3.22E-38 mr1137_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335708031 NA 1.08E-07 mr1137_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335708031 3.71E-06 3.71E-06 mr1147_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335708031 NA 8.90E-08 mr1521_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335708031 NA 8.52E-06 mr1596_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335708031 NA 3.13E-24 mr1611_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335708031 NA 7.44E-12 mr1611_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335708031 NA 9.34E-29 mr1617_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335708031 NA 6.03E-06 mr1617_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335708031 NA 1.31E-06 mr1851_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251