\
| Variant ID: vg0335650235 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 35650235 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, others allele: 0.00, population size: 291. )
TAGGCTAGTAGTTTAATTTCAAAACAAAGGTAACTCATGGTTGTTGCATATCTTTTGATCTGTAACTTGATAATAATTGGTACAATTCTCCAAAGCAAAA[T/C]
ACAGTGTGTAGCTTCATATACAGAATCAGGCGCACAATTAGTCTTGGATATTGCAGAAACAATTAGTTTGCATTTCAATAGGATAAATTTGTTACCAAAA
TTTTGGTAACAAATTTATCCTATTGAAATGCAAACTAATTGTTTCTGCAATATCCAAGACTAATTGTGCGCCTGATTCTGTATATGAAGCTACACACTGT[A/G]
TTTTGCTTTGGAGAATTGTACCAATTATTATCAAGTTACAGATCAAAAGATATGCAACAACCATGAGTTACCTTTGTTTTGAAATTAAACTACTAGCCTA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 94.20% | 4.70% | 1.10% | 0.00% | NA |
| All Indica | 2759 | 99.90% | 0.10% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 82.70% | 14.10% | 3.17% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.80% | 0.00% | 0.17% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 95.80% | 1.60% | 2.61% | 0.00% | NA |
| Tropical Japonica | 504 | 66.70% | 30.60% | 2.78% | 0.00% | NA |
| Japonica Intermediate | 241 | 74.70% | 19.50% | 5.81% | 0.00% | NA |
| VI/Aromatic | 96 | 97.90% | 1.00% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 92.20% | 5.60% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0335650235 | T -> C | LOC_Os03g63050.1 | upstream_gene_variant ; 3770.0bp to feature; MODIFIER | silent_mutation | Average:39.69; most accessible tissue: Callus, score: 66.775 | N | N | N | N |
| vg0335650235 | T -> C | LOC_Os03g63040.1 | intron_variant ; MODIFIER | silent_mutation | Average:39.69; most accessible tissue: Callus, score: 66.775 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0335650235 | NA | 5.44E-06 | mr1543 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0335650235 | NA | 1.85E-06 | mr1596 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0335650235 | NA | 2.54E-07 | mr1668 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0335650235 | 4.59E-09 | 7.05E-19 | mr1871 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0335650235 | NA | 2.16E-08 | mr1871 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0335650235 | NA | 2.20E-06 | mr1880 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0335650235 | NA | 1.38E-13 | mr1742_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0335650235 | NA | 1.94E-20 | mr1871_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |