Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0335633631:

Variant ID: vg0335633631 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 35633631
Reference Allele: TAlternative Allele: G
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, T: 0.01, others allele: 0.00, population size: 218. )

Flanking Sequence (100 bp) in Reference Genome:


CGTACCACCACAACCCTCCCGGTTTCCCTCGTAAATCCGGAAACCGAGCGGAGGTAGGATGGTCAATTCACCGCGCCGTCCGACTTCCCCACCGTGGCGT[T/G]
GGATATAATCTTCTCGTATCGTCTCGTCCCTCTTCCGTTTTTTCCCCCAATTTCTCGTCTCCCCCCTTCCTCCAATATATCGGCGGCGATCCCGGCTCGA

Reverse complement sequence

TCGAGCCGGGATCGCCGCCGATATATTGGAGGAAGGGGGGAGACGAGAAATTGGGGGAAAAAACGGAAGAGGGACGAGACGATACGAGAAGATTATATCC[A/C]
ACGCCACGGTGGGGAAGTCGGACGGCGCGGTGAATTGACCATCCTACCTCCGCTCGGTTTCCGGATTTACGAGGGAAACCGGGAGGGTTGTGGTGGTACG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 67.80% 32.00% 0.13% 0.00% NA
All Indica  2759 74.60% 25.20% 0.22% 0.00% NA
All Japonica  1512 47.00% 53.00% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 53.40% 45.90% 0.67% 0.00% NA
Indica II  465 88.40% 11.60% 0.00% 0.00% NA
Indica III  913 87.60% 12.40% 0.00% 0.00% NA
Indica Intermediate  786 67.30% 32.40% 0.25% 0.00% NA
Temperate Japonica  767 10.20% 89.80% 0.00% 0.00% NA
Tropical Japonica  504 94.60% 5.40% 0.00% 0.00% NA
Japonica Intermediate  241 64.70% 35.30% 0.00% 0.00% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 82.20% 17.80% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0335633631 T -> G LOC_Os03g63020.1 5_prime_UTR_variant ; 888.0bp to feature; MODIFIER silent_mutation Average:99.531; most accessible tissue: Zhenshan97 young leaf, score: 99.916 N N N N
vg0335633631 T -> G LOC_Os03g63020.2 5_prime_UTR_variant ; 888.0bp to feature; MODIFIER silent_mutation Average:99.531; most accessible tissue: Zhenshan97 young leaf, score: 99.916 N N N N
vg0335633631 T -> G LOC_Os03g63020.5 upstream_gene_variant ; 37.0bp to feature; MODIFIER silent_mutation Average:99.531; most accessible tissue: Zhenshan97 young leaf, score: 99.916 N N N N
vg0335633631 T -> G LOC_Os03g63020.3 upstream_gene_variant ; 174.0bp to feature; MODIFIER silent_mutation Average:99.531; most accessible tissue: Zhenshan97 young leaf, score: 99.916 N N N N
vg0335633631 T -> G LOC_Os03g63020.4 upstream_gene_variant ; 1182.0bp to feature; MODIFIER silent_mutation Average:99.531; most accessible tissue: Zhenshan97 young leaf, score: 99.916 N N N N
vg0335633631 T -> G LOC_Os03g63010.1 downstream_gene_variant ; 4012.0bp to feature; MODIFIER silent_mutation Average:99.531; most accessible tissue: Zhenshan97 young leaf, score: 99.916 N N N N
vg0335633631 T -> G LOC_Os03g63010.2 downstream_gene_variant ; 4012.0bp to feature; MODIFIER silent_mutation Average:99.531; most accessible tissue: Zhenshan97 young leaf, score: 99.916 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0335633631 T G -0.02 -0.01 -0.03 0.01 -0.01 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0335633631 NA 2.22E-06 mr1013 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335633631 NA 4.62E-06 mr1056 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335633631 NA 7.89E-09 mr1593 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335633631 NA 1.70E-06 mr1708 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335633631 NA 2.44E-07 mr1993 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335633631 NA 6.74E-08 mr1031_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335633631 NA 2.10E-08 mr1338_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335633631 NA 5.48E-08 mr1350_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335633631 NA 8.46E-06 mr1383_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335633631 NA 4.08E-10 mr1471_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335633631 NA 5.60E-06 mr1509_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335633631 NA 6.93E-09 mr1543_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335633631 NA 3.17E-07 mr1730_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335633631 NA 6.96E-06 mr1866_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335633631 NA 5.26E-08 mr1952_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335633631 NA 3.07E-07 mr1966_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335633631 NA 2.91E-06 mr1974_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251