\
| Variant ID: vg0335631588 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 35631588 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 97. )
CACATACCATGTCTTATACAGAAACAACCTTCAGATATAGGAGGAGTTTCGCACAAGGAAGGATGAATAAAGTTCTACATGGAAACGACAAGGACTACTC[G/A]
GATTGTATCCATATTGGTTTCCCTAGTTCTACTTGGACAAGGGGACACCTATAGGTATAAATATAAGGCCCCCTAGGAGGAGATGGGATACGGAACAATA
TATTGTTCCGTATCCCATCTCCTCCTAGGGGGCCTTATATTTATACCTATAGGTGTCCCCTTGTCCAAGTAGAACTAGGGAAACCAATATGGATACAATC[C/T]
GAGTAGTCCTTGTCGTTTCCATGTAGAACTTTATTCATCCTTCCTTGTGCGAAACTCCTCCTATATCTGAAGGTTGTTTCTGTATAAGACATGGTATGTG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 64.20% | 8.20% | 1.06% | 26.47% | NA |
| All Indica | 2759 | 40.70% | 14.00% | 1.81% | 43.53% | NA |
| All Japonica | 1512 | 97.80% | 0.10% | 0.00% | 2.05% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 21.50% | 0.20% | 3.19% | 75.13% | NA |
| Indica II | 465 | 32.50% | 8.80% | 1.94% | 56.77% | NA |
| Indica III | 913 | 54.40% | 29.80% | 0.33% | 15.44% | NA |
| Indica Intermediate | 786 | 44.10% | 9.00% | 2.42% | 44.40% | NA |
| Temperate Japonica | 767 | 96.20% | 0.00% | 0.00% | 3.78% | NA |
| Tropical Japonica | 504 | 99.40% | 0.40% | 0.00% | 0.20% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.00% | 0.00% | 0.41% | NA |
| VI/Aromatic | 96 | 97.90% | 0.00% | 0.00% | 2.08% | NA |
| Intermediate | 90 | 78.90% | 2.20% | 0.00% | 18.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0335631588 | G -> A | LOC_Os03g63020.1 | upstream_gene_variant ; 1958.0bp to feature; MODIFIER | silent_mutation | Average:38.827; most accessible tissue: Minghui63 flower, score: 75.689 | N | N | N | N |
| vg0335631588 | G -> A | LOC_Os03g63020.2 | upstream_gene_variant ; 1958.0bp to feature; MODIFIER | silent_mutation | Average:38.827; most accessible tissue: Minghui63 flower, score: 75.689 | N | N | N | N |
| vg0335631588 | G -> A | LOC_Os03g63020.5 | upstream_gene_variant ; 2080.0bp to feature; MODIFIER | silent_mutation | Average:38.827; most accessible tissue: Minghui63 flower, score: 75.689 | N | N | N | N |
| vg0335631588 | G -> A | LOC_Os03g63020.3 | upstream_gene_variant ; 2217.0bp to feature; MODIFIER | silent_mutation | Average:38.827; most accessible tissue: Minghui63 flower, score: 75.689 | N | N | N | N |
| vg0335631588 | G -> A | LOC_Os03g63020.4 | upstream_gene_variant ; 3225.0bp to feature; MODIFIER | silent_mutation | Average:38.827; most accessible tissue: Minghui63 flower, score: 75.689 | N | N | N | N |
| vg0335631588 | G -> A | LOC_Os03g63010.1 | downstream_gene_variant ; 1969.0bp to feature; MODIFIER | silent_mutation | Average:38.827; most accessible tissue: Minghui63 flower, score: 75.689 | N | N | N | N |
| vg0335631588 | G -> A | LOC_Os03g63010.2 | downstream_gene_variant ; 1969.0bp to feature; MODIFIER | silent_mutation | Average:38.827; most accessible tissue: Minghui63 flower, score: 75.689 | N | N | N | N |
| vg0335631588 | G -> A | LOC_Os03g63010-LOC_Os03g63020 | intergenic_region ; MODIFIER | silent_mutation | Average:38.827; most accessible tissue: Minghui63 flower, score: 75.689 | N | N | N | N |
| vg0335631588 | G -> DEL | N | N | silent_mutation | Average:38.827; most accessible tissue: Minghui63 flower, score: 75.689 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0335631588 | 6.60E-06 | 6.63E-06 | mr1117_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0335631588 | 5.36E-06 | 8.22E-06 | mr1119_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0335631588 | NA | 3.82E-06 | mr1120_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0335631588 | 6.74E-06 | NA | mr1123_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0335631588 | 7.57E-07 | 5.49E-06 | mr1240_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0335631588 | 7.84E-06 | 6.43E-07 | mr1247_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |