Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0335631588:

Variant ID: vg0335631588 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 35631588
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 97. )

Flanking Sequence (100 bp) in Reference Genome:

CACATACCATGTCTTATACAGAAACAACCTTCAGATATAGGAGGAGTTTCGCACAAGGAAGGATGAATAAAGTTCTACATGGAAACGACAAGGACTACTC[G/A]
GATTGTATCCATATTGGTTTCCCTAGTTCTACTTGGACAAGGGGACACCTATAGGTATAAATATAAGGCCCCCTAGGAGGAGATGGGATACGGAACAATA

Reverse complement sequence

TATTGTTCCGTATCCCATCTCCTCCTAGGGGGCCTTATATTTATACCTATAGGTGTCCCCTTGTCCAAGTAGAACTAGGGAAACCAATATGGATACAATC[C/T]
GAGTAGTCCTTGTCGTTTCCATGTAGAACTTTATTCATCCTTCCTTGTGCGAAACTCCTCCTATATCTGAAGGTTGTTTCTGTATAAGACATGGTATGTG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	64.20%	8.20%	1.06%	26.47%	NA
All Indica	2759	40.70%	14.00%	1.81%	43.53%	NA
All Japonica	1512	97.80%	0.10%	0.00%	2.05%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	21.50%	0.20%	3.19%	75.13%	NA
Indica II	465	32.50%	8.80%	1.94%	56.77%	NA
Indica III	913	54.40%	29.80%	0.33%	15.44%	NA
Indica Intermediate	786	44.10%	9.00%	2.42%	44.40%	NA
Temperate Japonica	767	96.20%	0.00%	0.00%	3.78%	NA
Tropical Japonica	504	99.40%	0.40%	0.00%	0.20%	NA
Japonica Intermediate	241	99.60%	0.00%	0.00%	0.41%	NA
VI/Aromatic	96	97.90%	0.00%	0.00%	2.08%	NA
Intermediate	90	78.90%	2.20%	0.00%	18.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0335631588	G -> A	LOC_Os03g63020.1	upstream_gene_variant ; 1958.0bp to feature; MODIFIER	silent_mutation	Average:38.827; most accessible tissue: Minghui63 flower, score: 75.689	N	N	N	N
vg0335631588	G -> A	LOC_Os03g63020.2	upstream_gene_variant ; 1958.0bp to feature; MODIFIER	silent_mutation	Average:38.827; most accessible tissue: Minghui63 flower, score: 75.689	N	N	N	N
vg0335631588	G -> A	LOC_Os03g63020.5	upstream_gene_variant ; 2080.0bp to feature; MODIFIER	silent_mutation	Average:38.827; most accessible tissue: Minghui63 flower, score: 75.689	N	N	N	N
vg0335631588	G -> A	LOC_Os03g63020.3	upstream_gene_variant ; 2217.0bp to feature; MODIFIER	silent_mutation	Average:38.827; most accessible tissue: Minghui63 flower, score: 75.689	N	N	N	N
vg0335631588	G -> A	LOC_Os03g63020.4	upstream_gene_variant ; 3225.0bp to feature; MODIFIER	silent_mutation	Average:38.827; most accessible tissue: Minghui63 flower, score: 75.689	N	N	N	N
vg0335631588	G -> A	LOC_Os03g63010.1	downstream_gene_variant ; 1969.0bp to feature; MODIFIER	silent_mutation	Average:38.827; most accessible tissue: Minghui63 flower, score: 75.689	N	N	N	N
vg0335631588	G -> A	LOC_Os03g63010.2	downstream_gene_variant ; 1969.0bp to feature; MODIFIER	silent_mutation	Average:38.827; most accessible tissue: Minghui63 flower, score: 75.689	N	N	N	N
vg0335631588	G -> A	LOC_Os03g63010-LOC_Os03g63020	intergenic_region ; MODIFIER	silent_mutation	Average:38.827; most accessible tissue: Minghui63 flower, score: 75.689	N	N	N	N
vg0335631588	G -> DEL	N	N	silent_mutation	Average:38.827; most accessible tissue: Minghui63 flower, score: 75.689	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0335631588	6.60E-06	6.63E-06	mr1117_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335631588	5.36E-06	8.22E-06	mr1119_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335631588	NA	3.82E-06	mr1120_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335631588	6.74E-06	NA	mr1123_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335631588	7.57E-07	5.49E-06	mr1240_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335631588	7.84E-06	6.43E-07	mr1247_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251