\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0335631588:

Variant ID: vg0335631588 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 35631588
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 97. )

Flanking Sequence (100 bp) in Reference Genome:


CACATACCATGTCTTATACAGAAACAACCTTCAGATATAGGAGGAGTTTCGCACAAGGAAGGATGAATAAAGTTCTACATGGAAACGACAAGGACTACTC[G/A]
GATTGTATCCATATTGGTTTCCCTAGTTCTACTTGGACAAGGGGACACCTATAGGTATAAATATAAGGCCCCCTAGGAGGAGATGGGATACGGAACAATA

Reverse complement sequence

TATTGTTCCGTATCCCATCTCCTCCTAGGGGGCCTTATATTTATACCTATAGGTGTCCCCTTGTCCAAGTAGAACTAGGGAAACCAATATGGATACAATC[C/T]
GAGTAGTCCTTGTCGTTTCCATGTAGAACTTTATTCATCCTTCCTTGTGCGAAACTCCTCCTATATCTGAAGGTTGTTTCTGTATAAGACATGGTATGTG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 64.20% 8.20% 1.06% 26.47% NA
All Indica  2759 40.70% 14.00% 1.81% 43.53% NA
All Japonica  1512 97.80% 0.10% 0.00% 2.05% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 21.50% 0.20% 3.19% 75.13% NA
Indica II  465 32.50% 8.80% 1.94% 56.77% NA
Indica III  913 54.40% 29.80% 0.33% 15.44% NA
Indica Intermediate  786 44.10% 9.00% 2.42% 44.40% NA
Temperate Japonica  767 96.20% 0.00% 0.00% 3.78% NA
Tropical Japonica  504 99.40% 0.40% 0.00% 0.20% NA
Japonica Intermediate  241 99.60% 0.00% 0.00% 0.41% NA
VI/Aromatic  96 97.90% 0.00% 0.00% 2.08% NA
Intermediate  90 78.90% 2.20% 0.00% 18.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0335631588 G -> A LOC_Os03g63020.1 upstream_gene_variant ; 1958.0bp to feature; MODIFIER silent_mutation Average:38.827; most accessible tissue: Minghui63 flower, score: 75.689 N N N N
vg0335631588 G -> A LOC_Os03g63020.2 upstream_gene_variant ; 1958.0bp to feature; MODIFIER silent_mutation Average:38.827; most accessible tissue: Minghui63 flower, score: 75.689 N N N N
vg0335631588 G -> A LOC_Os03g63020.5 upstream_gene_variant ; 2080.0bp to feature; MODIFIER silent_mutation Average:38.827; most accessible tissue: Minghui63 flower, score: 75.689 N N N N
vg0335631588 G -> A LOC_Os03g63020.3 upstream_gene_variant ; 2217.0bp to feature; MODIFIER silent_mutation Average:38.827; most accessible tissue: Minghui63 flower, score: 75.689 N N N N
vg0335631588 G -> A LOC_Os03g63020.4 upstream_gene_variant ; 3225.0bp to feature; MODIFIER silent_mutation Average:38.827; most accessible tissue: Minghui63 flower, score: 75.689 N N N N
vg0335631588 G -> A LOC_Os03g63010.1 downstream_gene_variant ; 1969.0bp to feature; MODIFIER silent_mutation Average:38.827; most accessible tissue: Minghui63 flower, score: 75.689 N N N N
vg0335631588 G -> A LOC_Os03g63010.2 downstream_gene_variant ; 1969.0bp to feature; MODIFIER silent_mutation Average:38.827; most accessible tissue: Minghui63 flower, score: 75.689 N N N N
vg0335631588 G -> A LOC_Os03g63010-LOC_Os03g63020 intergenic_region ; MODIFIER silent_mutation Average:38.827; most accessible tissue: Minghui63 flower, score: 75.689 N N N N
vg0335631588 G -> DEL N N silent_mutation Average:38.827; most accessible tissue: Minghui63 flower, score: 75.689 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0335631588 6.60E-06 6.63E-06 mr1117_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335631588 5.36E-06 8.22E-06 mr1119_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335631588 NA 3.82E-06 mr1120_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335631588 6.74E-06 NA mr1123_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335631588 7.57E-07 5.49E-06 mr1240_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335631588 7.84E-06 6.43E-07 mr1247_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251