\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0335630368:

Variant ID: vg0335630368 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 35630368
Reference Allele: GAlternative Allele: T
Primary Allele: TSecondary Allele: G

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, G: 0.01, others allele: 0.00, population size: 227. )

Flanking Sequence (100 bp) in Reference Genome:


ACATCGAACCACTGATGCACAACAGAAAAACAATCAACATTTAGGTCCAAGTAGCAGGAGGCATTTCAACCGAGATGATTCTGAACATGTCACCAGACGG[G/T]
CGCTGCAACTTGGTGAAAGGATGGGCAGATTTCGCAACAAATAAGAACATATCTCGGATCAGTCTGCATCTTCCACTTCTATAAAACAACTTACTTGGAA

Reverse complement sequence

TTCCAAGTAAGTTGTTTTATAGAAGTGGAAGATGCAGACTGATCCGAGATATGTTCTTATTTGTTGCGAAATCTGCCCATCCTTTCACCAAGTTGCAGCG[C/A]
CCGTCTGGTGACATGTTCAGAATCATCTCGGTTGAAATGCCTCCTGCTACTTGGACCTAAATGTTGATTGTTTTTCTGTTGTGCATCAGTGGTTCGATGT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 36.20% 35.60% 0.87% 27.30% NA
All Indica  2759 49.90% 3.80% 1.38% 44.91% NA
All Japonica  1512 1.70% 96.10% 0.07% 2.12% NA
Aus  269 99.30% 0.70% 0.00% 0.00% NA
Indica I  595 17.10% 3.40% 2.86% 76.64% NA
Indica II  465 36.30% 4.30% 1.08% 58.28% NA
Indica III  913 80.70% 3.10% 0.33% 15.88% NA
Indica Intermediate  786 46.90% 4.70% 1.65% 46.69% NA
Temperate Japonica  767 0.10% 96.10% 0.13% 3.65% NA
Tropical Japonica  504 4.80% 94.80% 0.00% 0.40% NA
Japonica Intermediate  241 0.40% 98.80% 0.00% 0.83% NA
VI/Aromatic  96 7.30% 89.60% 0.00% 3.12% NA
Intermediate  90 38.90% 41.10% 2.22% 17.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0335630368 G -> T LOC_Os03g63020.1 upstream_gene_variant ; 3178.0bp to feature; MODIFIER silent_mutation Average:41.898; most accessible tissue: Minghui63 flower, score: 75.455 N N N N
vg0335630368 G -> T LOC_Os03g63020.2 upstream_gene_variant ; 3178.0bp to feature; MODIFIER silent_mutation Average:41.898; most accessible tissue: Minghui63 flower, score: 75.455 N N N N
vg0335630368 G -> T LOC_Os03g63020.5 upstream_gene_variant ; 3300.0bp to feature; MODIFIER silent_mutation Average:41.898; most accessible tissue: Minghui63 flower, score: 75.455 N N N N
vg0335630368 G -> T LOC_Os03g63020.3 upstream_gene_variant ; 3437.0bp to feature; MODIFIER silent_mutation Average:41.898; most accessible tissue: Minghui63 flower, score: 75.455 N N N N
vg0335630368 G -> T LOC_Os03g63020.4 upstream_gene_variant ; 4445.0bp to feature; MODIFIER silent_mutation Average:41.898; most accessible tissue: Minghui63 flower, score: 75.455 N N N N
vg0335630368 G -> T LOC_Os03g63010.1 downstream_gene_variant ; 749.0bp to feature; MODIFIER silent_mutation Average:41.898; most accessible tissue: Minghui63 flower, score: 75.455 N N N N
vg0335630368 G -> T LOC_Os03g63010.2 downstream_gene_variant ; 749.0bp to feature; MODIFIER silent_mutation Average:41.898; most accessible tissue: Minghui63 flower, score: 75.455 N N N N
vg0335630368 G -> T LOC_Os03g63010-LOC_Os03g63020 intergenic_region ; MODIFIER silent_mutation Average:41.898; most accessible tissue: Minghui63 flower, score: 75.455 N N N N
vg0335630368 G -> DEL N N silent_mutation Average:41.898; most accessible tissue: Minghui63 flower, score: 75.455 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0335630368 NA 2.46E-06 mr1004 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335630368 NA 1.73E-16 mr1146 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335630368 NA 2.70E-06 mr1291 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335630368 NA 1.05E-09 mr1332 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335630368 5.59E-06 2.15E-13 mr1471 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335630368 2.39E-06 NA mr1645 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335630368 6.89E-06 NA mr1647 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335630368 7.53E-07 NA mr1682 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335630368 7.44E-06 2.04E-13 mr1722 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335630368 NA 2.08E-07 mr1815 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335630368 NA 1.18E-22 mr1095_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335630368 NA 3.54E-23 mr1099_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335630368 NA 7.69E-09 mr1222_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335630368 NA 1.99E-06 mr1471_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335630368 NA 6.26E-08 mr1654_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335630368 NA 5.88E-07 mr1815_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335630368 NA 8.15E-07 mr1815_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335630368 NA 3.54E-12 mr1918_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335630368 NA 5.79E-06 mr1929_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251