Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0335630368:

Variant ID: vg0335630368 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 35630368
Reference Allele: G	Alternative Allele: T
Primary Allele: T	Secondary Allele: G

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, G: 0.01, others allele: 0.00, population size: 227. )

Flanking Sequence (100 bp) in Reference Genome:

ACATCGAACCACTGATGCACAACAGAAAAACAATCAACATTTAGGTCCAAGTAGCAGGAGGCATTTCAACCGAGATGATTCTGAACATGTCACCAGACGG[G/T]
CGCTGCAACTTGGTGAAAGGATGGGCAGATTTCGCAACAAATAAGAACATATCTCGGATCAGTCTGCATCTTCCACTTCTATAAAACAACTTACTTGGAA

Reverse complement sequence

TTCCAAGTAAGTTGTTTTATAGAAGTGGAAGATGCAGACTGATCCGAGATATGTTCTTATTTGTTGCGAAATCTGCCCATCCTTTCACCAAGTTGCAGCG[C/A]
CCGTCTGGTGACATGTTCAGAATCATCTCGGTTGAAATGCCTCCTGCTACTTGGACCTAAATGTTGATTGTTTTTCTGTTGTGCATCAGTGGTTCGATGT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	36.20%	35.60%	0.87%	27.30%	NA
All Indica	2759	49.90%	3.80%	1.38%	44.91%	NA
All Japonica	1512	1.70%	96.10%	0.07%	2.12%	NA
Aus	269	99.30%	0.70%	0.00%	0.00%	NA
Indica I	595	17.10%	3.40%	2.86%	76.64%	NA
Indica II	465	36.30%	4.30%	1.08%	58.28%	NA
Indica III	913	80.70%	3.10%	0.33%	15.88%	NA
Indica Intermediate	786	46.90%	4.70%	1.65%	46.69%	NA
Temperate Japonica	767	0.10%	96.10%	0.13%	3.65%	NA
Tropical Japonica	504	4.80%	94.80%	0.00%	0.40%	NA
Japonica Intermediate	241	0.40%	98.80%	0.00%	0.83%	NA
VI/Aromatic	96	7.30%	89.60%	0.00%	3.12%	NA
Intermediate	90	38.90%	41.10%	2.22%	17.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0335630368	G -> T	LOC_Os03g63020.1	upstream_gene_variant ; 3178.0bp to feature; MODIFIER	silent_mutation	Average:41.898; most accessible tissue: Minghui63 flower, score: 75.455	N	N	N	N
vg0335630368	G -> T	LOC_Os03g63020.2	upstream_gene_variant ; 3178.0bp to feature; MODIFIER	silent_mutation	Average:41.898; most accessible tissue: Minghui63 flower, score: 75.455	N	N	N	N
vg0335630368	G -> T	LOC_Os03g63020.5	upstream_gene_variant ; 3300.0bp to feature; MODIFIER	silent_mutation	Average:41.898; most accessible tissue: Minghui63 flower, score: 75.455	N	N	N	N
vg0335630368	G -> T	LOC_Os03g63020.3	upstream_gene_variant ; 3437.0bp to feature; MODIFIER	silent_mutation	Average:41.898; most accessible tissue: Minghui63 flower, score: 75.455	N	N	N	N
vg0335630368	G -> T	LOC_Os03g63020.4	upstream_gene_variant ; 4445.0bp to feature; MODIFIER	silent_mutation	Average:41.898; most accessible tissue: Minghui63 flower, score: 75.455	N	N	N	N
vg0335630368	G -> T	LOC_Os03g63010.1	downstream_gene_variant ; 749.0bp to feature; MODIFIER	silent_mutation	Average:41.898; most accessible tissue: Minghui63 flower, score: 75.455	N	N	N	N
vg0335630368	G -> T	LOC_Os03g63010.2	downstream_gene_variant ; 749.0bp to feature; MODIFIER	silent_mutation	Average:41.898; most accessible tissue: Minghui63 flower, score: 75.455	N	N	N	N
vg0335630368	G -> T	LOC_Os03g63010-LOC_Os03g63020	intergenic_region ; MODIFIER	silent_mutation	Average:41.898; most accessible tissue: Minghui63 flower, score: 75.455	N	N	N	N
vg0335630368	G -> DEL	N	N	silent_mutation	Average:41.898; most accessible tissue: Minghui63 flower, score: 75.455	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0335630368	NA	2.46E-06	mr1004	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335630368	NA	1.73E-16	mr1146	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335630368	NA	2.70E-06	mr1291	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335630368	NA	1.05E-09	mr1332	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335630368	5.59E-06	2.15E-13	mr1471	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335630368	2.39E-06	NA	mr1645	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335630368	6.89E-06	NA	mr1647	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335630368	7.53E-07	NA	mr1682	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335630368	7.44E-06	2.04E-13	mr1722	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335630368	NA	2.08E-07	mr1815	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335630368	NA	1.18E-22	mr1095_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335630368	NA	3.54E-23	mr1099_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335630368	NA	7.69E-09	mr1222_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335630368	NA	1.99E-06	mr1471_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335630368	NA	6.26E-08	mr1654_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335630368	NA	5.88E-07	mr1815_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335630368	NA	8.15E-07	mr1815_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335630368	NA	3.54E-12	mr1918_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335630368	NA	5.79E-06	mr1929_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251