Variant ID: vg0335613340 (JBrowse) | Variation Type: SNP |
Chromosome: chr03 | Position: 35613340 |
Reference Allele: C | Alternative Allele: T,A |
Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.92, T: 0.07, others allele: 0.00, population size: 107. )
TATTATCTAGTAAGTCAGAAGAATCCTCAAGACCTAGGGTTAAATATAAAATTCAAATTCAAAAGAAATTCAAATGAAATCCAAAAATAGGGCAAAATAA[C/T,A]
ATAAAATGAGAATAGCAAAAAAAAAGCTTTAGAAGGTAGAGAATGATTTTAGAAGAATTTTGGTCTAAGTTTCATTAGAATTGGGTTTATATTTAAAAGA
TCTTTTAAATATAAACCCAATTCTAATGAAACTTAGACCAAAATTCTTCTAAAATCATTCTCTACCTTCTAAAGCTTTTTTTTTGCTATTCTCATTTTAT[G/A,T]
TTATTTTGCCCTATTTTTGGATTTCATTTGAATTTCTTTTGAATTTGAATTTTATATTTAACCCTAGGTCTTGAGGATTCTTCTGACTTACTAGATAATA
Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 86.50% | 13.00% | 0.25% | 0.30% | NA |
All Indica | 2759 | 83.30% | 15.80% | 0.43% | 0.51% | NA |
All Japonica | 1512 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
Aus | 269 | 43.90% | 56.10% | 0.00% | 0.00% | NA |
Indica I | 595 | 93.80% | 5.40% | 0.67% | 0.17% | NA |
Indica II | 465 | 91.20% | 8.60% | 0.22% | 0.00% | NA |
Indica III | 913 | 69.40% | 29.60% | 0.00% | 0.99% | NA |
Indica Intermediate | 786 | 86.80% | 11.80% | 0.89% | 0.51% | NA |
Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Tropical Japonica | 504 | 96.60% | 3.40% | 0.00% | 0.00% | NA |
Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
VI/Aromatic | 96 | 92.70% | 7.30% | 0.00% | 0.00% | NA |
Intermediate | 90 | 95.60% | 4.40% | 0.00% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0335613340 | C -> T | LOC_Os03g62974.1 | downstream_gene_variant ; 2048.0bp to feature; MODIFIER | silent_mutation | Average:27.774; most accessible tissue: Minghui63 panicle, score: 38.588 | N | N | N | N |
vg0335613340 | C -> T | LOC_Os03g62950-LOC_Os03g62974 | intergenic_region ; MODIFIER | silent_mutation | Average:27.774; most accessible tissue: Minghui63 panicle, score: 38.588 | N | N | N | N |
vg0335613340 | C -> A | LOC_Os03g62974.1 | downstream_gene_variant ; 2048.0bp to feature; MODIFIER | N | Average:27.774; most accessible tissue: Minghui63 panicle, score: 38.588 | N | N | N | N |
vg0335613340 | C -> A | LOC_Os03g62950-LOC_Os03g62974 | intergenic_region ; MODIFIER | N | Average:27.774; most accessible tissue: Minghui63 panicle, score: 38.588 | N | N | N | N |
vg0335613340 | C -> DEL | N | N | silent_mutation | Average:27.774; most accessible tissue: Minghui63 panicle, score: 38.588 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0335613340 | 4.00E-06 | 5.84E-06 | mr1120 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |