\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0335609936:

Variant ID: vg0335609936 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 35609936
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.75, A: 0.25, others allele: 0.00, population size: 200. )

Flanking Sequence (100 bp) in Reference Genome:


TATCCGATGTCACCTCAAAAATATTCTCTCCCAACGGCCACATTTTGGGGATCTATAAATACCCCCCACCTAACCCTTTTCTAGGGTTACCCAACTCATT[C/A]
ATTTACATTCACTTTGGGTTGAGCTTGGTGCTAAGGTGCTTTGAATCTTTGAGCTCTTTCTCCCTCAATCAAATCCCTCCTCATTCTTTGTGTGGTGGAT

Reverse complement sequence

ATCCACCACACAAAGAATGAGGAGGGATTTGATTGAGGGAGAAAGAGCTCAAAGATTCAAAGCACCTTAGCACCAAGCTCAACCCAAAGTGAATGTAAAT[G/T]
AATGAGTTGGGTAACCCTAGAAAAGGGTTAGGTGGGGGGTATTTATAGATCCCCAAAATGTGGCCGTTGGGAGAGAATATTTTTGAGGTGACATCGGATA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 69.70% 30.20% 0.06% 0.00% NA
All Indica  2759 55.60% 44.30% 0.11% 0.00% NA
All Japonica  1512 98.70% 1.30% 0.00% 0.00% NA
Aus  269 43.90% 56.10% 0.00% 0.00% NA
Indica I  595 87.70% 12.30% 0.00% 0.00% NA
Indica II  465 72.00% 27.70% 0.22% 0.00% NA
Indica III  913 20.90% 79.10% 0.00% 0.00% NA
Indica Intermediate  786 61.70% 38.00% 0.25% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 96.20% 3.80% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 90.60% 9.40% 0.00% 0.00% NA
Intermediate  90 72.20% 27.80% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0335609936 C -> A LOC_Os03g62950.1 upstream_gene_variant ; 2070.0bp to feature; MODIFIER silent_mutation Average:37.701; most accessible tissue: Zhenshan97 root, score: 57.64 N N N N
vg0335609936 C -> A LOC_Os03g62950-LOC_Os03g62974 intergenic_region ; MODIFIER silent_mutation Average:37.701; most accessible tissue: Zhenshan97 root, score: 57.64 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0335609936 NA 1.67E-06 Spikelet_length Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0335609936 1.48E-06 NA mr1165_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335609936 NA 9.52E-06 mr1216_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335609936 NA 3.88E-06 mr1452_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335609936 NA 3.63E-06 mr1462_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335609936 8.80E-06 3.96E-07 mr1471_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335609936 5.79E-06 NA mr1477_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335609936 NA 2.47E-06 mr1582_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335609936 NA 2.80E-07 mr1879_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251