\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0335559333:

Variant ID: vg0335559333 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 35559333
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GTCTTAAAAAAAAAGGCCAAAAAAGCATGCAAGATGAAACTTGTTTATAGCCCGGGTTTAGTTCTCAACTTTTTCTTCAAACTTTCAACTTTTCTATCAC[A/G]
TCAAAACTTTTCTACACACATAAATTTACAACTTTTTTCTTCAAACTTTCAATTTTAATCAAATTTCCAATTTTGATGTGTAACTAAACACACCATAGAT

Reverse complement sequence

ATCTATGGTGTGTTTAGTTACACATCAAAATTGGAAATTTGATTAAAATTGAAAGTTTGAAGAAAAAAGTTGTAAATTTATGTGTGTAGAAAAGTTTTGA[T/C]
GTGATAGAAAAGTTGAAAGTTTGAAGAAAAAGTTGAGAACTAAACCCGGGCTATAAACAAGTTTCATCTTGCATGCTTTTTTGGCCTTTTTTTTTAAGAC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 95.20% 4.20% 0.61% 0.00% NA
All Indica  2759 99.90% 0.00% 0.11% 0.00% NA
All Japonica  1512 85.40% 12.90% 1.72% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.80% 0.00% 0.17% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 99.90% 0.00% 0.11% 0.00% NA
Indica Intermediate  786 99.90% 0.00% 0.13% 0.00% NA
Temperate Japonica  767 98.70% 0.00% 1.30% 0.00% NA
Tropical Japonica  504 60.10% 37.30% 2.58% 0.00% NA
Japonica Intermediate  241 95.90% 2.90% 1.24% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 97.80% 2.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0335559333 A -> G LOC_Os03g62850.1 upstream_gene_variant ; 1285.0bp to feature; MODIFIER silent_mutation Average:41.137; most accessible tissue: Zhenshan97 flower, score: 65.596 N N N N
vg0335559333 A -> G LOC_Os03g62850.2 upstream_gene_variant ; 1285.0bp to feature; MODIFIER silent_mutation Average:41.137; most accessible tissue: Zhenshan97 flower, score: 65.596 N N N N
vg0335559333 A -> G LOC_Os03g62870.1 downstream_gene_variant ; 3421.0bp to feature; MODIFIER silent_mutation Average:41.137; most accessible tissue: Zhenshan97 flower, score: 65.596 N N N N
vg0335559333 A -> G LOC_Os03g62870.2 downstream_gene_variant ; 3421.0bp to feature; MODIFIER silent_mutation Average:41.137; most accessible tissue: Zhenshan97 flower, score: 65.596 N N N N
vg0335559333 A -> G LOC_Os03g62870.3 downstream_gene_variant ; 3421.0bp to feature; MODIFIER silent_mutation Average:41.137; most accessible tissue: Zhenshan97 flower, score: 65.596 N N N N
vg0335559333 A -> G LOC_Os03g62870.4 downstream_gene_variant ; 3421.0bp to feature; MODIFIER silent_mutation Average:41.137; most accessible tissue: Zhenshan97 flower, score: 65.596 N N N N
vg0335559333 A -> G LOC_Os03g62860.1 intron_variant ; MODIFIER silent_mutation Average:41.137; most accessible tissue: Zhenshan97 flower, score: 65.596 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0335559333 2.54E-06 1.26E-08 mr1422 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335559333 NA 6.29E-07 mr1422_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335559333 NA 1.29E-06 mr1850_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251