\
| Variant ID: vg0335543608 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 35543608 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
GTAACATATGTAGGTAATAACATGCTTATTATCTTCTTCATCCTTTTATTTTTTGAGTTCCAAAATCAAAGTGAAATTTACGACTTATCTTCTTCCTCTT[C/T]
CCTTTTTTTTTTTTTGAGTTTTGAGTTCCAAAATCCGACTAAGTAATTTTTCTCCACCTCTTCTATCGTATTTTTTTATCTCCCTCTGTTTTTATGTTTG
CAAACATAAAAACAGAGGGAGATAAAAAAATACGATAGAAGAGGTGGAGAAAAATTACTTAGTCGGATTTTGGAACTCAAAACTCAAAAAAAAAAAAAGG[G/A]
AAGAGGAAGAAGATAAGTCGTAAATTTCACTTTGATTTTGGAACTCAAAAAATAAAAGGATGAAGAAGATAATAAGCATGTTATTACCTACATATGTTAC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 68.70% | 31.20% | 0.15% | 0.00% | NA |
| All Indica | 2759 | 75.80% | 24.10% | 0.11% | 0.00% | NA |
| All Japonica | 1512 | 54.40% | 45.50% | 0.13% | 0.00% | NA |
| Aus | 269 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Indica I | 595 | 65.50% | 34.10% | 0.34% | 0.00% | NA |
| Indica II | 465 | 48.20% | 51.80% | 0.00% | 0.00% | NA |
| Indica III | 913 | 94.60% | 5.40% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 78.10% | 21.80% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 89.60% | 10.40% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 9.70% | 90.10% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 35.70% | 63.90% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 12.50% | 86.50% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 58.90% | 40.00% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0335543608 | C -> T | LOC_Os03g62840.1 | upstream_gene_variant ; 4073.0bp to feature; MODIFIER | silent_mutation | Average:52.128; most accessible tissue: Callus, score: 64.108 | N | N | N | N |
| vg0335543608 | C -> T | LOC_Os03g62820.1 | downstream_gene_variant ; 3461.0bp to feature; MODIFIER | silent_mutation | Average:52.128; most accessible tissue: Callus, score: 64.108 | N | N | N | N |
| vg0335543608 | C -> T | LOC_Os03g62830.1 | downstream_gene_variant ; 128.0bp to feature; MODIFIER | silent_mutation | Average:52.128; most accessible tissue: Callus, score: 64.108 | N | N | N | N |
| vg0335543608 | C -> T | LOC_Os03g62820-LOC_Os03g62830 | intergenic_region ; MODIFIER | silent_mutation | Average:52.128; most accessible tissue: Callus, score: 64.108 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0335543608 | NA | 2.75E-06 | mr1013 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0335543608 | 3.93E-07 | NA | mr1026 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0335543608 | NA | 1.59E-06 | mr1536 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0335543608 | NA | 9.60E-06 | mr1871 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0335543608 | NA | 1.78E-08 | mr1338_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0335543608 | NA | 2.78E-06 | mr1383_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0335543608 | NA | 6.47E-09 | mr1543_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0335543608 | NA | 1.68E-06 | mr1730_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0335543608 | NA | 4.22E-08 | mr1952_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0335543608 | NA | 8.19E-07 | mr1966_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |