\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0335543608:

Variant ID: vg0335543608 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 35543608
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GTAACATATGTAGGTAATAACATGCTTATTATCTTCTTCATCCTTTTATTTTTTGAGTTCCAAAATCAAAGTGAAATTTACGACTTATCTTCTTCCTCTT[C/T]
CCTTTTTTTTTTTTTGAGTTTTGAGTTCCAAAATCCGACTAAGTAATTTTTCTCCACCTCTTCTATCGTATTTTTTTATCTCCCTCTGTTTTTATGTTTG

Reverse complement sequence

CAAACATAAAAACAGAGGGAGATAAAAAAATACGATAGAAGAGGTGGAGAAAAATTACTTAGTCGGATTTTGGAACTCAAAACTCAAAAAAAAAAAAAGG[G/A]
AAGAGGAAGAAGATAAGTCGTAAATTTCACTTTGATTTTGGAACTCAAAAAATAAAAGGATGAAGAAGATAATAAGCATGTTATTACCTACATATGTTAC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 68.70% 31.20% 0.15% 0.00% NA
All Indica  2759 75.80% 24.10% 0.11% 0.00% NA
All Japonica  1512 54.40% 45.50% 0.13% 0.00% NA
Aus  269 99.30% 0.70% 0.00% 0.00% NA
Indica I  595 65.50% 34.10% 0.34% 0.00% NA
Indica II  465 48.20% 51.80% 0.00% 0.00% NA
Indica III  913 94.60% 5.40% 0.00% 0.00% NA
Indica Intermediate  786 78.10% 21.80% 0.13% 0.00% NA
Temperate Japonica  767 89.60% 10.40% 0.00% 0.00% NA
Tropical Japonica  504 9.70% 90.10% 0.20% 0.00% NA
Japonica Intermediate  241 35.70% 63.90% 0.41% 0.00% NA
VI/Aromatic  96 12.50% 86.50% 1.04% 0.00% NA
Intermediate  90 58.90% 40.00% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0335543608 C -> T LOC_Os03g62840.1 upstream_gene_variant ; 4073.0bp to feature; MODIFIER silent_mutation Average:52.128; most accessible tissue: Callus, score: 64.108 N N N N
vg0335543608 C -> T LOC_Os03g62820.1 downstream_gene_variant ; 3461.0bp to feature; MODIFIER silent_mutation Average:52.128; most accessible tissue: Callus, score: 64.108 N N N N
vg0335543608 C -> T LOC_Os03g62830.1 downstream_gene_variant ; 128.0bp to feature; MODIFIER silent_mutation Average:52.128; most accessible tissue: Callus, score: 64.108 N N N N
vg0335543608 C -> T LOC_Os03g62820-LOC_Os03g62830 intergenic_region ; MODIFIER silent_mutation Average:52.128; most accessible tissue: Callus, score: 64.108 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0335543608 NA 2.75E-06 mr1013 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335543608 3.93E-07 NA mr1026 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335543608 NA 1.59E-06 mr1536 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335543608 NA 9.60E-06 mr1871 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335543608 NA 1.78E-08 mr1338_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335543608 NA 2.78E-06 mr1383_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335543608 NA 6.47E-09 mr1543_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335543608 NA 1.68E-06 mr1730_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335543608 NA 4.22E-08 mr1952_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335543608 NA 8.19E-07 mr1966_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251