\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0335517007:

Variant ID: vg0335517007 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 35517007
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.02, others allele: 0.00, population size: 313. )

Flanking Sequence (100 bp) in Reference Genome:


AGTGTAGTAAATGGAAACTGGTGGTGGTGGGTCTAGCCTTATCTGCTGCTATAATGTGCCTATGGAGGATCACCAATTCATGCCTATCTGCTGCTTCAGC[A/G]
TGTTCACCCAAGGATAGGCAATTGACCATACGTGCTAGTTGCGAGCTTCAGACAGACAGGATACAGCTACAGGAGTCGATTCTTACAAGAAGATAGTAGG

Reverse complement sequence

CCTACTATCTTCTTGTAAGAATCGACTCCTGTAGCTGTATCCTGTCTGTCTGAAGCTCGCAACTAGCACGTATGGTCAATTGCCTATCCTTGGGTGAACA[T/C]
GCTGAAGCAGCAGATAGGCATGAATTGGTGATCCTCCATAGGCACATTATAGCAGCAGATAAGGCTAGACCCACCACCACCAGTTTCCATTTACTACACT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 70.10% 29.80% 0.11% 0.00% NA
All Indica  2759 78.10% 21.80% 0.04% 0.00% NA
All Japonica  1512 47.80% 52.00% 0.26% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 97.80% 2.20% 0.00% 0.00% NA
Indica II  465 84.10% 15.90% 0.00% 0.00% NA
Indica III  913 58.40% 41.50% 0.11% 0.00% NA
Indica Intermediate  786 82.70% 17.30% 0.00% 0.00% NA
Temperate Japonica  767 11.50% 88.00% 0.52% 0.00% NA
Tropical Japonica  504 94.60% 5.40% 0.00% 0.00% NA
Japonica Intermediate  241 65.10% 34.90% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 76.70% 23.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0335517007 A -> G LOC_Os03g62750.1 3_prime_UTR_variant ; 126.0bp to feature; MODIFIER silent_mutation Average:83.698; most accessible tissue: Minghui63 young leaf, score: 92.035 N N N N
vg0335517007 A -> G LOC_Os03g62760.1 3_prime_UTR_variant ; 540.0bp to feature; MODIFIER silent_mutation Average:83.698; most accessible tissue: Minghui63 young leaf, score: 92.035 N N N N
vg0335517007 A -> G LOC_Os03g62750.2 3_prime_UTR_variant ; 126.0bp to feature; MODIFIER silent_mutation Average:83.698; most accessible tissue: Minghui63 young leaf, score: 92.035 N N N N
vg0335517007 A -> G LOC_Os03g62750.3 3_prime_UTR_variant ; 126.0bp to feature; MODIFIER silent_mutation Average:83.698; most accessible tissue: Minghui63 young leaf, score: 92.035 N N N N
vg0335517007 A -> G LOC_Os03g62750.4 3_prime_UTR_variant ; 325.0bp to feature; MODIFIER silent_mutation Average:83.698; most accessible tissue: Minghui63 young leaf, score: 92.035 N N N N
vg0335517007 A -> G LOC_Os03g62770.1 downstream_gene_variant ; 2087.0bp to feature; MODIFIER silent_mutation Average:83.698; most accessible tissue: Minghui63 young leaf, score: 92.035 N N N N
vg0335517007 A -> G LOC_Os03g62780.1 downstream_gene_variant ; 3533.0bp to feature; MODIFIER silent_mutation Average:83.698; most accessible tissue: Minghui63 young leaf, score: 92.035 N N N N
vg0335517007 A -> G LOC_Os03g62780.2 downstream_gene_variant ; 3533.0bp to feature; MODIFIER silent_mutation Average:83.698; most accessible tissue: Minghui63 young leaf, score: 92.035 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0335517007 A G 0.12 0.1 0.03 0.06 0.12 0.13

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0335517007 NA 4.28E-07 mr1013 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335517007 NA 5.37E-07 mr1031 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335517007 NA 1.26E-06 mr1056 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335517007 NA 3.92E-08 mr1031_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335517007 NA 4.63E-06 mr1119_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335517007 4.26E-06 NA mr1155_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335517007 NA 6.59E-11 mr1216_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335517007 5.10E-07 4.95E-08 mr1216_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335517007 NA 6.25E-08 mr1229_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335517007 NA 7.26E-07 mr1250_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335517007 NA 8.07E-07 mr1252_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335517007 NA 2.29E-07 mr1350_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335517007 NA 6.35E-06 mr1472_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335517007 NA 6.92E-06 mr1528_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335517007 NA 8.07E-07 mr1554_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335517007 NA 1.25E-07 mr1730_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335517007 NA 9.33E-06 mr1763_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335517007 NA 6.11E-06 mr1840_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335517007 NA 5.23E-06 mr1866_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335517007 NA 3.16E-08 mr1880_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335517007 NA 2.37E-07 mr1966_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251