\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0335383525:

Variant ID: vg0335383525 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 35383525
Reference Allele: AAlternative Allele: C
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.72, A: 0.29, others allele: 0.00, population size: 272. )

Flanking Sequence (100 bp) in Reference Genome:


ATGAAGAAATAAACAGTGCCATTGATATGTCTTAACAATTGTCACTAAAACTACAGGTAGTAAACTTATCAAGGAATATGGTGAAAGCCATCTAAACCAG[A/C]
AATAATCCATTGCATCTTTGCTTACCTGTGCTCTGATGATCGCACTCCTCTTGTCTTGTTCAGCCTTCTCAACAATGAACTTTGCACGCTCAGCTTCTTG

Reverse complement sequence

CAAGAAGCTGAGCGTGCAAAGTTCATTGTTGAGAAGGCTGAACAAGACAAGAGGAGTGCGATCATCAGAGCACAGGTAAGCAAAGATGCAATGGATTATT[T/G]
CTGGTTTAGATGGCTTTCACCATATTCCTTGATAAGTTTACTACCTGTAGTTTTAGTGACAATTGTTAAGACATATCAATGGCACTGTTTATTTCTTCAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 76.80% 23.00% 0.17% 0.00% NA
All Indica  2759 90.10% 9.90% 0.00% 0.00% NA
All Japonica  1512 47.10% 52.40% 0.53% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 99.50% 0.50% 0.00% 0.00% NA
Indica II  465 87.10% 12.90% 0.00% 0.00% NA
Indica III  913 86.50% 13.50% 0.00% 0.00% NA
Indica Intermediate  786 88.80% 11.20% 0.00% 0.00% NA
Temperate Japonica  767 10.70% 88.30% 1.04% 0.00% NA
Tropical Japonica  504 93.30% 6.70% 0.00% 0.00% NA
Japonica Intermediate  241 66.40% 33.60% 0.00% 0.00% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 78.90% 21.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0335383525 A -> C LOC_Os03g62480.1 upstream_gene_variant ; 1544.0bp to feature; MODIFIER silent_mutation Average:56.656; most accessible tissue: Zhenshan97 panicle, score: 71.253 N N N N
vg0335383525 A -> C LOC_Os03g62500.1 downstream_gene_variant ; 2257.0bp to feature; MODIFIER silent_mutation Average:56.656; most accessible tissue: Zhenshan97 panicle, score: 71.253 N N N N
vg0335383525 A -> C LOC_Os03g62490.1 intron_variant ; MODIFIER silent_mutation Average:56.656; most accessible tissue: Zhenshan97 panicle, score: 71.253 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0335383525 6.26E-07 6.26E-07 mr1770 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335383525 NA 2.05E-25 mr1115_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335383525 NA 6.06E-07 mr1117_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335383525 NA 2.01E-07 mr1119_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335383525 NA 5.81E-06 mr1120_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335383525 7.65E-06 NA mr1123_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335383525 NA 5.38E-07 mr1180_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335383525 NA 7.66E-07 mr1183_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335383525 NA 1.24E-06 mr1229_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335383525 NA 5.53E-06 mr1232_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335383525 NA 6.81E-06 mr1247_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335383525 NA 9.52E-07 mr1554_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335383525 NA 2.77E-06 mr1730_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335383525 NA 2.05E-07 mr1748_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335383525 NA 2.69E-08 mr1794_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251