Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0335354580:

Variant ID: vg0335354580 (JBrowse)Variation Type: INDEL
Chromosome: chr03Position: 35354580
Reference Allele: GAlternative Allele: C,GCGCCGACGCCGC
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GTTGGGGATGACCCGCGTCTGCGCGACGGTGGCGCCGGCGAGGCAGACGGAGACGTAGGGGTCGCTGGTGATGATCTTCTTGGGCCTGACGCCGCCGCCG[G/C,GCGCCGACGCCGC]
CCCGGCGCGCGTTGTCGCCGGTGCCGCCGCACGAGGAGCCGCAGGCGCCGTAGCCGGTGAAGAAGCGGCGCATCCGCTCCGACATGATGTCCATGTTGGG

Reverse complement sequence

CCCAACATGGACATCATGTCGGAGCGGATGCGCCGCTTCTTCACCGGCTACGGCGCCTGCGGCTCCTCGTGCGGCGGCACCGGCGACAACGCGCGCCGGG[C/G,GCGGCGTCGGCGC]
CGGCGGCGGCGTCAGGCCCAAGAAGATCATCACCAGCGACCCCTACGTCTCCGTCTGCCTCGCCGGCGCCACCGTCGCGCAGACGCGGGTCATCCCCAAC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 71.10% 28.80% 0.11% 0.00% GCGCCGACGCCGC: 0.04%
All Indica  2759 80.60% 19.20% 0.18% 0.00% NA
All Japonica  1512 46.80% 53.20% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 97.00% 2.50% 0.50% 0.00% NA
Indica II  465 83.00% 17.00% 0.00% 0.00% NA
Indica III  913 65.30% 34.60% 0.11% 0.00% NA
Indica Intermediate  786 84.60% 15.30% 0.13% 0.00% NA
Temperate Japonica  767 10.40% 89.60% 0.00% 0.00% NA
Tropical Japonica  504 92.90% 7.10% 0.00% 0.00% NA
Japonica Intermediate  241 66.40% 33.60% 0.00% 0.00% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 72.20% 25.60% 0.00% 0.00% GCGCCGACGCCGC: 2.22%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0335354580 G -> C LOC_Os03g62410.1 missense_variant ; p.Ala66Gly; MODERATE nonsynonymous_codon ; A66G Average:78.882; most accessible tissue: Zhenshan97 flower, score: 91.289 unknown unknown TOLERATED 0.40
vg0335354580 G -> GCGCCGACGCCGC LOC_Os03g62410.1 inframe_insertion ; p.Arg65_Ala66insGlyGlyValGly; MODERATE inframe_variant Average:78.882; most accessible tissue: Zhenshan97 flower, score: 91.289 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0335354580 G C -0.02 -0.02 -0.04 -0.02 -0.03 -0.03
vg0335354580 G GCGCC* -0.17 -0.16 -0.16 0.03 -0.08 -0.04

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0335354580 NA 5.31E-25 mr1115_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335354580 4.92E-06 2.79E-07 mr1117_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335354580 2.16E-07 2.45E-08 mr1119_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335354580 3.67E-06 NA mr1123_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335354580 NA 2.58E-07 mr1180_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335354580 NA 5.42E-07 mr1183_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335354580 NA 4.60E-07 mr1229_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335354580 NA 1.21E-06 mr1232_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335354580 NA 6.65E-06 mr1233_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335354580 NA 3.31E-06 mr1247_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335354580 NA 3.05E-07 mr1338_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335354580 NA 3.92E-06 mr1730_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335354580 NA 4.41E-09 mr1748_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335354580 NA 2.96E-08 mr1794_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335354580 NA 3.76E-06 mr1910_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251