Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0335349500:

Variant ID: vg0335349500 (JBrowse)	Variation Type: INDEL
Chromosome: chr03	Position: 35349500
Reference Allele: A	Alternative Allele: G,AGCCAAACG
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AGGCTGAAATATAAACTACGATGAAAAACCTCCAAAATTAACTCCAAATTCAATGTTGAAAATTTAAATTTTAACTTATAAGTATAAGCATAAGCCAAAC[A/G,AGCCAAACG]
ATGAGGCTGTAAAGCATCGAAAATAGAAAATACTAAAATATAGTGGGTCTATTTGTTAATTCCTGTAAGTTTATCCTAATTATCAAAGGGATAAGTATTT

Reverse complement sequence

AAATACTTATCCCTTTGATAATTAGGATAAACTTACAGGAATTAACAAATAGACCCACTATATTTTAGTATTTTCTATTTTCGATGCTTTACAGCCTCAT[T/C,CGTTTGGCT]
GTTTGGCTTATGCTTATACTTATAAGTTAAAATTTAAATTTTCAACATTGAATTTGGAGTTAATTTTGGAGGTTTTTCATCGTAGTTTATATTTCAGCCT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	67.70%	23.20%	2.98%	0.78%	AGCCAAACG: 5.27%
All Indica	2759	75.10%	9.90%	4.89%	1.34%	AGCCAAACG: 8.70%
All Japonica	1512	46.70%	53.00%	0.13%	0.00%	AGCCAAACG: 0.13%
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	94.30%	0.50%	2.86%	0.17%	AGCCAAACG: 2.18%
Indica II	465	76.30%	12.90%	2.80%	0.22%	AGCCAAACG: 7.74%
Indica III	913	60.60%	13.50%	8.43%	3.40%	AGCCAAACG: 14.13%
Indica Intermediate	786	76.80%	11.20%	3.56%	0.51%	AGCCAAACG: 7.89%
Temperate Japonica	767	10.30%	89.60%	0.13%	0.00%	NA
Tropical Japonica	504	92.70%	6.70%	0.20%	0.00%	AGCCAAACG: 0.40%
Japonica Intermediate	241	66.40%	33.60%	0.00%	0.00%	NA
VI/Aromatic	96	96.90%	3.10%	0.00%	0.00%	NA
Intermediate	90	66.70%	21.10%	4.44%	0.00%	AGCCAAACG: 7.78%

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0335349500	A -> AGCCAAACG	LOC_Os03g62400.1	upstream_gene_variant ; 474.0bp to feature; MODIFIER	silent_mutation	Average:68.854; most accessible tissue: Callus, score: 90.777	N	N	N	N
vg0335349500	A -> AGCCAAACG	LOC_Os03g62410.1	downstream_gene_variant ; 695.0bp to feature; MODIFIER	silent_mutation	Average:68.854; most accessible tissue: Callus, score: 90.777	N	N	N	N
vg0335349500	A -> AGCCAAACG	LOC_Os03g62410.2	downstream_gene_variant ; 695.0bp to feature; MODIFIER	silent_mutation	Average:68.854; most accessible tissue: Callus, score: 90.777	N	N	N	N
vg0335349500	A -> AGCCAAACG	LOC_Os03g62400-LOC_Os03g62410	intergenic_region ; MODIFIER	silent_mutation	Average:68.854; most accessible tissue: Callus, score: 90.777	N	N	N	N
vg0335349500	A -> DEL	N	N	silent_mutation	Average:68.854; most accessible tissue: Callus, score: 90.777	N	N	N	N
vg0335349500	A -> G	LOC_Os03g62400.1	upstream_gene_variant ; 473.0bp to feature; MODIFIER	silent_mutation	Average:68.854; most accessible tissue: Callus, score: 90.777	N	N	N	N
vg0335349500	A -> G	LOC_Os03g62410.1	downstream_gene_variant ; 696.0bp to feature; MODIFIER	silent_mutation	Average:68.854; most accessible tissue: Callus, score: 90.777	N	N	N	N
vg0335349500	A -> G	LOC_Os03g62410.2	downstream_gene_variant ; 696.0bp to feature; MODIFIER	silent_mutation	Average:68.854; most accessible tissue: Callus, score: 90.777	N	N	N	N
vg0335349500	A -> G	LOC_Os03g62400-LOC_Os03g62410	intergenic_region ; MODIFIER	silent_mutation	Average:68.854; most accessible tissue: Callus, score: 90.777	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0335349500	NA	3.45E-06	mr1232	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335349500	6.35E-06	NA	mr1103_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335349500	NA	2.46E-06	mr1105_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335349500	NA	5.12E-26	mr1115_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335349500	NA	2.58E-07	mr1180_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335349500	NA	5.42E-07	mr1183_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335349500	NA	1.16E-07	mr1229_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335349500	4.77E-06	1.92E-08	mr1232_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335349500	9.71E-06	3.77E-08	mr1233_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335349500	NA	2.37E-07	mr1252_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335349500	NA	3.05E-07	mr1338_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335349500	NA	2.59E-08	mr1557_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335349500	NA	7.07E-06	mr1705_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335349500	NA	3.92E-06	mr1730_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335349500	NA	6.04E-06	mr1763_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335349500	NA	2.96E-08	mr1794_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335349500	5.31E-06	3.66E-08	mr1949_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251