\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0335349500:

Variant ID: vg0335349500 (JBrowse)Variation Type: INDEL
Chromosome: chr03Position: 35349500
Reference Allele: AAlternative Allele: G,AGCCAAACG
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AGGCTGAAATATAAACTACGATGAAAAACCTCCAAAATTAACTCCAAATTCAATGTTGAAAATTTAAATTTTAACTTATAAGTATAAGCATAAGCCAAAC[A/G,AGCCAAACG]
ATGAGGCTGTAAAGCATCGAAAATAGAAAATACTAAAATATAGTGGGTCTATTTGTTAATTCCTGTAAGTTTATCCTAATTATCAAAGGGATAAGTATTT

Reverse complement sequence

AAATACTTATCCCTTTGATAATTAGGATAAACTTACAGGAATTAACAAATAGACCCACTATATTTTAGTATTTTCTATTTTCGATGCTTTACAGCCTCAT[T/C,CGTTTGGCT]
GTTTGGCTTATGCTTATACTTATAAGTTAAAATTTAAATTTTCAACATTGAATTTGGAGTTAATTTTGGAGGTTTTTCATCGTAGTTTATATTTCAGCCT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 67.70% 23.20% 2.98% 0.78% AGCCAAACG: 5.27%
All Indica  2759 75.10% 9.90% 4.89% 1.34% AGCCAAACG: 8.70%
All Japonica  1512 46.70% 53.00% 0.13% 0.00% AGCCAAACG: 0.13%
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 94.30% 0.50% 2.86% 0.17% AGCCAAACG: 2.18%
Indica II  465 76.30% 12.90% 2.80% 0.22% AGCCAAACG: 7.74%
Indica III  913 60.60% 13.50% 8.43% 3.40% AGCCAAACG: 14.13%
Indica Intermediate  786 76.80% 11.20% 3.56% 0.51% AGCCAAACG: 7.89%
Temperate Japonica  767 10.30% 89.60% 0.13% 0.00% NA
Tropical Japonica  504 92.70% 6.70% 0.20% 0.00% AGCCAAACG: 0.40%
Japonica Intermediate  241 66.40% 33.60% 0.00% 0.00% NA
VI/Aromatic  96 96.90% 3.10% 0.00% 0.00% NA
Intermediate  90 66.70% 21.10% 4.44% 0.00% AGCCAAACG: 7.78%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0335349500 A -> AGCCAAACG LOC_Os03g62400.1 upstream_gene_variant ; 474.0bp to feature; MODIFIER silent_mutation Average:68.854; most accessible tissue: Callus, score: 90.777 N N N N
vg0335349500 A -> AGCCAAACG LOC_Os03g62410.1 downstream_gene_variant ; 695.0bp to feature; MODIFIER silent_mutation Average:68.854; most accessible tissue: Callus, score: 90.777 N N N N
vg0335349500 A -> AGCCAAACG LOC_Os03g62410.2 downstream_gene_variant ; 695.0bp to feature; MODIFIER silent_mutation Average:68.854; most accessible tissue: Callus, score: 90.777 N N N N
vg0335349500 A -> AGCCAAACG LOC_Os03g62400-LOC_Os03g62410 intergenic_region ; MODIFIER silent_mutation Average:68.854; most accessible tissue: Callus, score: 90.777 N N N N
vg0335349500 A -> DEL N N silent_mutation Average:68.854; most accessible tissue: Callus, score: 90.777 N N N N
vg0335349500 A -> G LOC_Os03g62400.1 upstream_gene_variant ; 473.0bp to feature; MODIFIER silent_mutation Average:68.854; most accessible tissue: Callus, score: 90.777 N N N N
vg0335349500 A -> G LOC_Os03g62410.1 downstream_gene_variant ; 696.0bp to feature; MODIFIER silent_mutation Average:68.854; most accessible tissue: Callus, score: 90.777 N N N N
vg0335349500 A -> G LOC_Os03g62410.2 downstream_gene_variant ; 696.0bp to feature; MODIFIER silent_mutation Average:68.854; most accessible tissue: Callus, score: 90.777 N N N N
vg0335349500 A -> G LOC_Os03g62400-LOC_Os03g62410 intergenic_region ; MODIFIER silent_mutation Average:68.854; most accessible tissue: Callus, score: 90.777 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0335349500 NA 3.45E-06 mr1232 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335349500 6.35E-06 NA mr1103_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335349500 NA 2.46E-06 mr1105_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335349500 NA 5.12E-26 mr1115_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335349500 NA 2.58E-07 mr1180_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335349500 NA 5.42E-07 mr1183_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335349500 NA 1.16E-07 mr1229_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335349500 4.77E-06 1.92E-08 mr1232_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335349500 9.71E-06 3.77E-08 mr1233_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335349500 NA 2.37E-07 mr1252_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335349500 NA 3.05E-07 mr1338_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335349500 NA 2.59E-08 mr1557_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335349500 NA 7.07E-06 mr1705_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335349500 NA 3.92E-06 mr1730_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335349500 NA 6.04E-06 mr1763_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335349500 NA 2.96E-08 mr1794_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335349500 5.31E-06 3.66E-08 mr1949_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251