\
| Variant ID: vg0335349500 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr03 | Position: 35349500 |
| Reference Allele: A | Alternative Allele: G,AGCCAAACG |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
AGGCTGAAATATAAACTACGATGAAAAACCTCCAAAATTAACTCCAAATTCAATGTTGAAAATTTAAATTTTAACTTATAAGTATAAGCATAAGCCAAAC[A/G,AGCCAAACG]
ATGAGGCTGTAAAGCATCGAAAATAGAAAATACTAAAATATAGTGGGTCTATTTGTTAATTCCTGTAAGTTTATCCTAATTATCAAAGGGATAAGTATTT
AAATACTTATCCCTTTGATAATTAGGATAAACTTACAGGAATTAACAAATAGACCCACTATATTTTAGTATTTTCTATTTTCGATGCTTTACAGCCTCAT[T/C,CGTTTGGCT]
GTTTGGCTTATGCTTATACTTATAAGTTAAAATTTAAATTTTCAACATTGAATTTGGAGTTAATTTTGGAGGTTTTTCATCGTAGTTTATATTTCAGCCT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 67.70% | 23.20% | 2.98% | 0.78% | AGCCAAACG: 5.27% |
| All Indica | 2759 | 75.10% | 9.90% | 4.89% | 1.34% | AGCCAAACG: 8.70% |
| All Japonica | 1512 | 46.70% | 53.00% | 0.13% | 0.00% | AGCCAAACG: 0.13% |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 94.30% | 0.50% | 2.86% | 0.17% | AGCCAAACG: 2.18% |
| Indica II | 465 | 76.30% | 12.90% | 2.80% | 0.22% | AGCCAAACG: 7.74% |
| Indica III | 913 | 60.60% | 13.50% | 8.43% | 3.40% | AGCCAAACG: 14.13% |
| Indica Intermediate | 786 | 76.80% | 11.20% | 3.56% | 0.51% | AGCCAAACG: 7.89% |
| Temperate Japonica | 767 | 10.30% | 89.60% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 92.70% | 6.70% | 0.20% | 0.00% | AGCCAAACG: 0.40% |
| Japonica Intermediate | 241 | 66.40% | 33.60% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 96.90% | 3.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 66.70% | 21.10% | 4.44% | 0.00% | AGCCAAACG: 7.78% |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0335349500 | A -> AGCCAAACG | LOC_Os03g62400.1 | upstream_gene_variant ; 474.0bp to feature; MODIFIER | silent_mutation | Average:68.854; most accessible tissue: Callus, score: 90.777 | N | N | N | N |
| vg0335349500 | A -> AGCCAAACG | LOC_Os03g62410.1 | downstream_gene_variant ; 695.0bp to feature; MODIFIER | silent_mutation | Average:68.854; most accessible tissue: Callus, score: 90.777 | N | N | N | N |
| vg0335349500 | A -> AGCCAAACG | LOC_Os03g62410.2 | downstream_gene_variant ; 695.0bp to feature; MODIFIER | silent_mutation | Average:68.854; most accessible tissue: Callus, score: 90.777 | N | N | N | N |
| vg0335349500 | A -> AGCCAAACG | LOC_Os03g62400-LOC_Os03g62410 | intergenic_region ; MODIFIER | silent_mutation | Average:68.854; most accessible tissue: Callus, score: 90.777 | N | N | N | N |
| vg0335349500 | A -> DEL | N | N | silent_mutation | Average:68.854; most accessible tissue: Callus, score: 90.777 | N | N | N | N |
| vg0335349500 | A -> G | LOC_Os03g62400.1 | upstream_gene_variant ; 473.0bp to feature; MODIFIER | silent_mutation | Average:68.854; most accessible tissue: Callus, score: 90.777 | N | N | N | N |
| vg0335349500 | A -> G | LOC_Os03g62410.1 | downstream_gene_variant ; 696.0bp to feature; MODIFIER | silent_mutation | Average:68.854; most accessible tissue: Callus, score: 90.777 | N | N | N | N |
| vg0335349500 | A -> G | LOC_Os03g62410.2 | downstream_gene_variant ; 696.0bp to feature; MODIFIER | silent_mutation | Average:68.854; most accessible tissue: Callus, score: 90.777 | N | N | N | N |
| vg0335349500 | A -> G | LOC_Os03g62400-LOC_Os03g62410 | intergenic_region ; MODIFIER | silent_mutation | Average:68.854; most accessible tissue: Callus, score: 90.777 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0335349500 | NA | 3.45E-06 | mr1232 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0335349500 | 6.35E-06 | NA | mr1103_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0335349500 | NA | 2.46E-06 | mr1105_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0335349500 | NA | 5.12E-26 | mr1115_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0335349500 | NA | 2.58E-07 | mr1180_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0335349500 | NA | 5.42E-07 | mr1183_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0335349500 | NA | 1.16E-07 | mr1229_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0335349500 | 4.77E-06 | 1.92E-08 | mr1232_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0335349500 | 9.71E-06 | 3.77E-08 | mr1233_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0335349500 | NA | 2.37E-07 | mr1252_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0335349500 | NA | 3.05E-07 | mr1338_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0335349500 | NA | 2.59E-08 | mr1557_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0335349500 | NA | 7.07E-06 | mr1705_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0335349500 | NA | 3.92E-06 | mr1730_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0335349500 | NA | 6.04E-06 | mr1763_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0335349500 | NA | 2.96E-08 | mr1794_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0335349500 | 5.31E-06 | 3.66E-08 | mr1949_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |