\
| Variant ID: vg0335272611 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 35272611 |
| Reference Allele: T | Alternative Allele: A |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.98, T: 0.02, others allele: 0.00, population size: 115. )
TCGAACACCATGATGCCTGACGCATTCACGATTGAGCGAACATAAAGTCATGCTTAATATTATCATTTTTTTTCTTGGGATAGCCTAACTAACATTGACA[T/A]
AAAAATCCTAAAAATATCAAGTATAATTACAATATAACTAGTACGTAGTATATAATTATAATAGCATAAGTTATAAGCAACTATATAAACCCGCGGCAGC
GCTGCCGCGGGTTTATATAGTTGCTTATAACTTATGCTATTATAATTATATACTACGTACTAGTTATATTGTAATTATACTTGATATTTTTAGGATTTTT[A/T]
TGTCAATGTTAGTTAGGCTATCCCAAGAAAAAAAATGATAATATTAAGCATGACTTTATGTTCGCTCAATCGTGAATGCGTCAGGCATCATGGTGTTCGA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 55.00% | 44.80% | 0.23% | 0.00% | NA |
| All Indica | 2759 | 28.30% | 71.30% | 0.36% | 0.00% | NA |
| All Japonica | 1512 | 99.10% | 0.90% | 0.07% | 0.00% | NA |
| Aus | 269 | 65.40% | 34.60% | 0.00% | 0.00% | NA |
| Indica I | 595 | 35.80% | 63.20% | 1.01% | 0.00% | NA |
| Indica II | 465 | 12.00% | 88.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 32.50% | 67.10% | 0.33% | 0.00% | NA |
| Indica Intermediate | 786 | 27.50% | 72.40% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 99.00% | 0.90% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 98.80% | 1.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 52.20% | 47.80% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0335272611 | T -> A | LOC_Os03g62270.1 | downstream_gene_variant ; 2862.0bp to feature; MODIFIER | silent_mutation | Average:67.812; most accessible tissue: Minghui63 flower, score: 83.835 | N | N | N | N |
| vg0335272611 | T -> A | LOC_Os03g62270-LOC_Os03g62280 | intergenic_region ; MODIFIER | silent_mutation | Average:67.812; most accessible tissue: Minghui63 flower, score: 83.835 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0335272611 | NA | 8.51E-13 | mr1503 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0335272611 | NA | 2.77E-21 | mr1627_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0335272611 | NA | 1.70E-06 | mr1928_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |