\
| Variant ID: vg0335246131 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 35246131 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
TCTATCGATCAATAATACTCTCGGCACATCGCCACCCTCTTCCCTGAGGTTTTCACTTATCTTCCGGCGGAACTTGGGCACCTGACGCAGGGCTGCATCG[A/G]
CTTTCGATCTCCAACGAAGGGGTAAGTCCTACGTTCTGTTGGGCCCTGGTGAATCTGTCGGCTATGTTGGTGTTGTTCAAGGCTGCATCGATTCGATCTC
GAGATCGAATCGATGCAGCCTTGAACAACACCAACATAGCCGACAGATTCACCAGGGCCCAACAGAACGTAGGACTTACCCCTTCGTTGGAGATCGAAAG[T/C]
CGATGCAGCCCTGCGTCAGGTGCCCAAGTTCCGCCGGAAGATAAGTGAAAACCTCAGGGAAGAGGGTGGCGATGTGCCGAGAGTATTATTGATCGATAGA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 52.10% | 24.20% | 1.18% | 22.49% | NA |
| All Indica | 2759 | 24.30% | 36.20% | 1.59% | 37.84% | NA |
| All Japonica | 1512 | 99.30% | 0.40% | 0.07% | 0.26% | NA |
| Aus | 269 | 53.90% | 43.10% | 2.97% | 0.00% | NA |
| Indica I | 595 | 37.30% | 21.70% | 1.51% | 39.50% | NA |
| Indica II | 465 | 10.10% | 60.20% | 4.73% | 24.95% | NA |
| Indica III | 913 | 23.50% | 26.80% | 0.33% | 49.29% | NA |
| Indica Intermediate | 786 | 23.80% | 44.00% | 1.27% | 30.92% | NA |
| Temperate Japonica | 767 | 99.60% | 0.30% | 0.00% | 0.13% | NA |
| Tropical Japonica | 504 | 98.40% | 0.80% | 0.20% | 0.60% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 55.60% | 24.40% | 3.33% | 16.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0335246131 | A -> DEL | N | N | silent_mutation | Average:35.624; most accessible tissue: Zhenshan97 flag leaf, score: 80.799 | N | N | N | N |
| vg0335246131 | A -> G | LOC_Os03g62220.1 | upstream_gene_variant ; 2161.0bp to feature; MODIFIER | silent_mutation | Average:35.624; most accessible tissue: Zhenshan97 flag leaf, score: 80.799 | N | N | N | N |
| vg0335246131 | A -> G | LOC_Os03g62200.1 | downstream_gene_variant ; 4155.0bp to feature; MODIFIER | silent_mutation | Average:35.624; most accessible tissue: Zhenshan97 flag leaf, score: 80.799 | N | N | N | N |
| vg0335246131 | A -> G | LOC_Os03g62210.1 | downstream_gene_variant ; 3206.0bp to feature; MODIFIER | silent_mutation | Average:35.624; most accessible tissue: Zhenshan97 flag leaf, score: 80.799 | N | N | N | N |
| vg0335246131 | A -> G | LOC_Os03g62224.1 | downstream_gene_variant ; 2125.0bp to feature; MODIFIER | silent_mutation | Average:35.624; most accessible tissue: Zhenshan97 flag leaf, score: 80.799 | N | N | N | N |
| vg0335246131 | A -> G | LOC_Os03g62220-LOC_Os03g62224 | intergenic_region ; MODIFIER | silent_mutation | Average:35.624; most accessible tissue: Zhenshan97 flag leaf, score: 80.799 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0335246131 | NA | 3.05E-06 | mr1095_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0335246131 | NA | 9.28E-06 | mr1099_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0335246131 | NA | 6.36E-07 | mr1257_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0335246131 | NA | 2.94E-13 | mr1377_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0335246131 | NA | 8.04E-09 | mr1377_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |