\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0335246131:

Variant ID: vg0335246131 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 35246131
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCTATCGATCAATAATACTCTCGGCACATCGCCACCCTCTTCCCTGAGGTTTTCACTTATCTTCCGGCGGAACTTGGGCACCTGACGCAGGGCTGCATCG[A/G]
CTTTCGATCTCCAACGAAGGGGTAAGTCCTACGTTCTGTTGGGCCCTGGTGAATCTGTCGGCTATGTTGGTGTTGTTCAAGGCTGCATCGATTCGATCTC

Reverse complement sequence

GAGATCGAATCGATGCAGCCTTGAACAACACCAACATAGCCGACAGATTCACCAGGGCCCAACAGAACGTAGGACTTACCCCTTCGTTGGAGATCGAAAG[T/C]
CGATGCAGCCCTGCGTCAGGTGCCCAAGTTCCGCCGGAAGATAAGTGAAAACCTCAGGGAAGAGGGTGGCGATGTGCCGAGAGTATTATTGATCGATAGA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 52.10% 24.20% 1.18% 22.49% NA
All Indica  2759 24.30% 36.20% 1.59% 37.84% NA
All Japonica  1512 99.30% 0.40% 0.07% 0.26% NA
Aus  269 53.90% 43.10% 2.97% 0.00% NA
Indica I  595 37.30% 21.70% 1.51% 39.50% NA
Indica II  465 10.10% 60.20% 4.73% 24.95% NA
Indica III  913 23.50% 26.80% 0.33% 49.29% NA
Indica Intermediate  786 23.80% 44.00% 1.27% 30.92% NA
Temperate Japonica  767 99.60% 0.30% 0.00% 0.13% NA
Tropical Japonica  504 98.40% 0.80% 0.20% 0.60% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 55.60% 24.40% 3.33% 16.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0335246131 A -> DEL N N silent_mutation Average:35.624; most accessible tissue: Zhenshan97 flag leaf, score: 80.799 N N N N
vg0335246131 A -> G LOC_Os03g62220.1 upstream_gene_variant ; 2161.0bp to feature; MODIFIER silent_mutation Average:35.624; most accessible tissue: Zhenshan97 flag leaf, score: 80.799 N N N N
vg0335246131 A -> G LOC_Os03g62200.1 downstream_gene_variant ; 4155.0bp to feature; MODIFIER silent_mutation Average:35.624; most accessible tissue: Zhenshan97 flag leaf, score: 80.799 N N N N
vg0335246131 A -> G LOC_Os03g62210.1 downstream_gene_variant ; 3206.0bp to feature; MODIFIER silent_mutation Average:35.624; most accessible tissue: Zhenshan97 flag leaf, score: 80.799 N N N N
vg0335246131 A -> G LOC_Os03g62224.1 downstream_gene_variant ; 2125.0bp to feature; MODIFIER silent_mutation Average:35.624; most accessible tissue: Zhenshan97 flag leaf, score: 80.799 N N N N
vg0335246131 A -> G LOC_Os03g62220-LOC_Os03g62224 intergenic_region ; MODIFIER silent_mutation Average:35.624; most accessible tissue: Zhenshan97 flag leaf, score: 80.799 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0335246131 NA 3.05E-06 mr1095_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335246131 NA 9.28E-06 mr1099_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335246131 NA 6.36E-07 mr1257_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335246131 NA 2.94E-13 mr1377_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335246131 NA 8.04E-09 mr1377_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251