Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0335246131:

Variant ID: vg0335246131 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 35246131
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TCTATCGATCAATAATACTCTCGGCACATCGCCACCCTCTTCCCTGAGGTTTTCACTTATCTTCCGGCGGAACTTGGGCACCTGACGCAGGGCTGCATCG[A/G]
CTTTCGATCTCCAACGAAGGGGTAAGTCCTACGTTCTGTTGGGCCCTGGTGAATCTGTCGGCTATGTTGGTGTTGTTCAAGGCTGCATCGATTCGATCTC

Reverse complement sequence

GAGATCGAATCGATGCAGCCTTGAACAACACCAACATAGCCGACAGATTCACCAGGGCCCAACAGAACGTAGGACTTACCCCTTCGTTGGAGATCGAAAG[T/C]
CGATGCAGCCCTGCGTCAGGTGCCCAAGTTCCGCCGGAAGATAAGTGAAAACCTCAGGGAAGAGGGTGGCGATGTGCCGAGAGTATTATTGATCGATAGA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	52.10%	24.20%	1.18%	22.49%	NA
All Indica	2759	24.30%	36.20%	1.59%	37.84%	NA
All Japonica	1512	99.30%	0.40%	0.07%	0.26%	NA
Aus	269	53.90%	43.10%	2.97%	0.00%	NA
Indica I	595	37.30%	21.70%	1.51%	39.50%	NA
Indica II	465	10.10%	60.20%	4.73%	24.95%	NA
Indica III	913	23.50%	26.80%	0.33%	49.29%	NA
Indica Intermediate	786	23.80%	44.00%	1.27%	30.92%	NA
Temperate Japonica	767	99.60%	0.30%	0.00%	0.13%	NA
Tropical Japonica	504	98.40%	0.80%	0.20%	0.60%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	55.60%	24.40%	3.33%	16.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0335246131	A -> DEL	N	N	silent_mutation	Average:35.624; most accessible tissue: Zhenshan97 flag leaf, score: 80.799	N	N	N	N
vg0335246131	A -> G	LOC_Os03g62220.1	upstream_gene_variant ; 2161.0bp to feature; MODIFIER	silent_mutation	Average:35.624; most accessible tissue: Zhenshan97 flag leaf, score: 80.799	N	N	N	N
vg0335246131	A -> G	LOC_Os03g62200.1	downstream_gene_variant ; 4155.0bp to feature; MODIFIER	silent_mutation	Average:35.624; most accessible tissue: Zhenshan97 flag leaf, score: 80.799	N	N	N	N
vg0335246131	A -> G	LOC_Os03g62210.1	downstream_gene_variant ; 3206.0bp to feature; MODIFIER	silent_mutation	Average:35.624; most accessible tissue: Zhenshan97 flag leaf, score: 80.799	N	N	N	N
vg0335246131	A -> G	LOC_Os03g62224.1	downstream_gene_variant ; 2125.0bp to feature; MODIFIER	silent_mutation	Average:35.624; most accessible tissue: Zhenshan97 flag leaf, score: 80.799	N	N	N	N
vg0335246131	A -> G	LOC_Os03g62220-LOC_Os03g62224	intergenic_region ; MODIFIER	silent_mutation	Average:35.624; most accessible tissue: Zhenshan97 flag leaf, score: 80.799	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0335246131	NA	3.05E-06	mr1095_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335246131	NA	9.28E-06	mr1099_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335246131	NA	6.36E-07	mr1257_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335246131	NA	2.94E-13	mr1377_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335246131	NA	8.04E-09	mr1377_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251