Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0335210290:

Variant ID: vg0335210290 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 35210290
Reference Allele: A	Alternative Allele: T
Primary Allele: A	Secondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 291. )

Flanking Sequence (100 bp) in Reference Genome:

CTGAATTTCTGTAGCAACACTGAAAATTGAGCAGAACAGTTAGTCATGTAATCTAATATTATGCACGTGGTAGATAACTTCAGAAACAGACCACATTGAG[A/T]
CACCATATTAATTTTGTCATGTGGATATGAAAACCATGTTAGATGAAGCTATTCTTCCACATCACTAGTCTCAACTCATTTTCCATGCTTTGGGAGCGAT

Reverse complement sequence

ATCGCTCCCAAAGCATGGAAAATGAGTTGAGACTAGTGATGTGGAAGAATAGCTTCATCTAACATGGTTTTCATATCCACATGACAAAATTAATATGGTG[T/A]
CTCAATGTGGTCTGTTTCTGAAGTTATCTACCACGTGCATAATATTAGATTACATGACTAACTGTTCTGCTCAATTTTCAGTGTTGCTACAGAAATTCAG

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	96.10%	2.80%	1.06%	0.00%	NA
All Indica	2759	99.40%	0.50%	0.07%	0.00%	NA
All Japonica	1512	89.00%	7.80%	3.17%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	98.70%	1.30%	0.00%	0.00%	NA
Indica II	465	99.80%	0.00%	0.22%	0.00%	NA
Indica III	913	99.80%	0.20%	0.00%	0.00%	NA
Indica Intermediate	786	99.40%	0.50%	0.13%	0.00%	NA
Temperate Japonica	767	80.70%	13.40%	5.87%	0.00%	NA
Tropical Japonica	504	99.60%	0.40%	0.00%	0.00%	NA
Japonica Intermediate	241	93.40%	5.40%	1.24%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	97.80%	2.20%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0335210290	A -> T	LOC_Os03g62170.1	upstream_gene_variant ; 2573.0bp to feature; MODIFIER	silent_mutation	Average:52.372; most accessible tissue: Callus, score: 78.254	N	N	N	N
vg0335210290	A -> T	LOC_Os03g62170.2	upstream_gene_variant ; 2598.0bp to feature; MODIFIER	silent_mutation	Average:52.372; most accessible tissue: Callus, score: 78.254	N	N	N	N
vg0335210290	A -> T	LOC_Os03g62140.1	downstream_gene_variant ; 3700.0bp to feature; MODIFIER	silent_mutation	Average:52.372; most accessible tissue: Callus, score: 78.254	N	N	N	N
vg0335210290	A -> T	LOC_Os03g62150.1	downstream_gene_variant ; 1959.0bp to feature; MODIFIER	silent_mutation	Average:52.372; most accessible tissue: Callus, score: 78.254	N	N	N	N
vg0335210290	A -> T	LOC_Os03g62160.2	intron_variant ; MODIFIER	silent_mutation	Average:52.372; most accessible tissue: Callus, score: 78.254	N	N	N	N
vg0335210290	A -> T	LOC_Os03g62160.1	intron_variant ; MODIFIER	silent_mutation	Average:52.372; most accessible tissue: Callus, score: 78.254	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0335210290	3.67E-06	NA	mr1024	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335210290	NA	1.32E-07	mr1062	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335210290	NA	9.83E-06	mr1565	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335210290	1.75E-08	NA	mr1024_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335210290	4.85E-06	4.85E-06	mr1024_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335210290	NA	1.68E-06	mr1062_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335210290	1.78E-06	NA	mr1565_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335210290	7.75E-06	9.31E-08	mr1565_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335210290	NA	2.16E-06	mr1915_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251