\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0335210290:

Variant ID: vg0335210290 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 35210290
Reference Allele: AAlternative Allele: T
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 291. )

Flanking Sequence (100 bp) in Reference Genome:


CTGAATTTCTGTAGCAACACTGAAAATTGAGCAGAACAGTTAGTCATGTAATCTAATATTATGCACGTGGTAGATAACTTCAGAAACAGACCACATTGAG[A/T]
CACCATATTAATTTTGTCATGTGGATATGAAAACCATGTTAGATGAAGCTATTCTTCCACATCACTAGTCTCAACTCATTTTCCATGCTTTGGGAGCGAT

Reverse complement sequence

ATCGCTCCCAAAGCATGGAAAATGAGTTGAGACTAGTGATGTGGAAGAATAGCTTCATCTAACATGGTTTTCATATCCACATGACAAAATTAATATGGTG[T/A]
CTCAATGTGGTCTGTTTCTGAAGTTATCTACCACGTGCATAATATTAGATTACATGACTAACTGTTCTGCTCAATTTTCAGTGTTGCTACAGAAATTCAG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 96.10% 2.80% 1.06% 0.00% NA
All Indica  2759 99.40% 0.50% 0.07% 0.00% NA
All Japonica  1512 89.00% 7.80% 3.17% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 98.70% 1.30% 0.00% 0.00% NA
Indica II  465 99.80% 0.00% 0.22% 0.00% NA
Indica III  913 99.80% 0.20% 0.00% 0.00% NA
Indica Intermediate  786 99.40% 0.50% 0.13% 0.00% NA
Temperate Japonica  767 80.70% 13.40% 5.87% 0.00% NA
Tropical Japonica  504 99.60% 0.40% 0.00% 0.00% NA
Japonica Intermediate  241 93.40% 5.40% 1.24% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 97.80% 2.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0335210290 A -> T LOC_Os03g62170.1 upstream_gene_variant ; 2573.0bp to feature; MODIFIER silent_mutation Average:52.372; most accessible tissue: Callus, score: 78.254 N N N N
vg0335210290 A -> T LOC_Os03g62170.2 upstream_gene_variant ; 2598.0bp to feature; MODIFIER silent_mutation Average:52.372; most accessible tissue: Callus, score: 78.254 N N N N
vg0335210290 A -> T LOC_Os03g62140.1 downstream_gene_variant ; 3700.0bp to feature; MODIFIER silent_mutation Average:52.372; most accessible tissue: Callus, score: 78.254 N N N N
vg0335210290 A -> T LOC_Os03g62150.1 downstream_gene_variant ; 1959.0bp to feature; MODIFIER silent_mutation Average:52.372; most accessible tissue: Callus, score: 78.254 N N N N
vg0335210290 A -> T LOC_Os03g62160.2 intron_variant ; MODIFIER silent_mutation Average:52.372; most accessible tissue: Callus, score: 78.254 N N N N
vg0335210290 A -> T LOC_Os03g62160.1 intron_variant ; MODIFIER silent_mutation Average:52.372; most accessible tissue: Callus, score: 78.254 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0335210290 3.67E-06 NA mr1024 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335210290 NA 1.32E-07 mr1062 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335210290 NA 9.83E-06 mr1565 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335210290 1.75E-08 NA mr1024_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335210290 4.85E-06 4.85E-06 mr1024_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335210290 NA 1.68E-06 mr1062_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335210290 1.78E-06 NA mr1565_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335210290 7.75E-06 9.31E-08 mr1565_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335210290 NA 2.16E-06 mr1915_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251