\
| Variant ID: vg0335210290 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 35210290 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 291. )
CTGAATTTCTGTAGCAACACTGAAAATTGAGCAGAACAGTTAGTCATGTAATCTAATATTATGCACGTGGTAGATAACTTCAGAAACAGACCACATTGAG[A/T]
CACCATATTAATTTTGTCATGTGGATATGAAAACCATGTTAGATGAAGCTATTCTTCCACATCACTAGTCTCAACTCATTTTCCATGCTTTGGGAGCGAT
ATCGCTCCCAAAGCATGGAAAATGAGTTGAGACTAGTGATGTGGAAGAATAGCTTCATCTAACATGGTTTTCATATCCACATGACAAAATTAATATGGTG[T/A]
CTCAATGTGGTCTGTTTCTGAAGTTATCTACCACGTGCATAATATTAGATTACATGACTAACTGTTCTGCTCAATTTTCAGTGTTGCTACAGAAATTCAG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 96.10% | 2.80% | 1.06% | 0.00% | NA |
| All Indica | 2759 | 99.40% | 0.50% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 89.00% | 7.80% | 3.17% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 98.70% | 1.30% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.80% | 0.00% | 0.22% | 0.00% | NA |
| Indica III | 913 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.40% | 0.50% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 80.70% | 13.40% | 5.87% | 0.00% | NA |
| Tropical Japonica | 504 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 93.40% | 5.40% | 1.24% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 97.80% | 2.20% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0335210290 | A -> T | LOC_Os03g62170.1 | upstream_gene_variant ; 2573.0bp to feature; MODIFIER | silent_mutation | Average:52.372; most accessible tissue: Callus, score: 78.254 | N | N | N | N |
| vg0335210290 | A -> T | LOC_Os03g62170.2 | upstream_gene_variant ; 2598.0bp to feature; MODIFIER | silent_mutation | Average:52.372; most accessible tissue: Callus, score: 78.254 | N | N | N | N |
| vg0335210290 | A -> T | LOC_Os03g62140.1 | downstream_gene_variant ; 3700.0bp to feature; MODIFIER | silent_mutation | Average:52.372; most accessible tissue: Callus, score: 78.254 | N | N | N | N |
| vg0335210290 | A -> T | LOC_Os03g62150.1 | downstream_gene_variant ; 1959.0bp to feature; MODIFIER | silent_mutation | Average:52.372; most accessible tissue: Callus, score: 78.254 | N | N | N | N |
| vg0335210290 | A -> T | LOC_Os03g62160.2 | intron_variant ; MODIFIER | silent_mutation | Average:52.372; most accessible tissue: Callus, score: 78.254 | N | N | N | N |
| vg0335210290 | A -> T | LOC_Os03g62160.1 | intron_variant ; MODIFIER | silent_mutation | Average:52.372; most accessible tissue: Callus, score: 78.254 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0335210290 | 3.67E-06 | NA | mr1024 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0335210290 | NA | 1.32E-07 | mr1062 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0335210290 | NA | 9.83E-06 | mr1565 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0335210290 | 1.75E-08 | NA | mr1024_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0335210290 | 4.85E-06 | 4.85E-06 | mr1024_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0335210290 | NA | 1.68E-06 | mr1062_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0335210290 | 1.78E-06 | NA | mr1565_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0335210290 | 7.75E-06 | 9.31E-08 | mr1565_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0335210290 | NA | 2.16E-06 | mr1915_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |