\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0335186694:

Variant ID: vg0335186694 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 35186694
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, C: 0.02, others allele: 0.00, population size: 113. )

Flanking Sequence (100 bp) in Reference Genome:


CCCACCGTTCCATATCGCAAGTTATTTTAGTTTTAGTCAAAGTTTAATTTTAACTTTTTATCAAGTTTACAGAAAATTAAAGATATACCAATATTTTTAA[T/C]
AACATATAAACAAACTATCACGATATATATTTTCTGGATTTTACGAAACTAATTTTATGTCACAGTGGTTGGTGTATTTTTTTTATATAAATCTAGCCAA

Reverse complement sequence

TTGGCTAGATTTATATAAAAAAAATACACCAACCACTGTGACATAAAATTAGTTTCGTAAAATCCAGAAAATATATATCGTGATAGTTTGTTTATATGTT[A/G]
TTAAAAATATTGGTATATCTTTAATTTTCTGTAAACTTGATAAAAAGTTAAAATTAAACTTTGACTAAAACTAAAATAACTTGCGATATGGAACGGTGGG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 77.40% 22.40% 0.15% 0.00% NA
All Indica  2759 64.30% 35.50% 0.25% 0.00% NA
All Japonica  1512 99.50% 0.50% 0.00% 0.00% NA
Aus  269 82.20% 17.80% 0.00% 0.00% NA
Indica I  595 81.20% 18.50% 0.34% 0.00% NA
Indica II  465 38.70% 61.10% 0.22% 0.00% NA
Indica III  913 74.20% 25.40% 0.44% 0.00% NA
Indica Intermediate  786 55.10% 44.90% 0.00% 0.00% NA
Temperate Japonica  767 99.70% 0.30% 0.00% 0.00% NA
Tropical Japonica  504 99.20% 0.80% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 73.30% 26.70% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0335186694 T -> C LOC_Os03g62110.2 upstream_gene_variant ; 4101.0bp to feature; MODIFIER silent_mutation Average:49.767; most accessible tissue: Callus, score: 80.14 N N N N
vg0335186694 T -> C LOC_Os03g62110.3 upstream_gene_variant ; 4101.0bp to feature; MODIFIER silent_mutation Average:49.767; most accessible tissue: Callus, score: 80.14 N N N N
vg0335186694 T -> C LOC_Os03g62090.1 downstream_gene_variant ; 3271.0bp to feature; MODIFIER silent_mutation Average:49.767; most accessible tissue: Callus, score: 80.14 N N N N
vg0335186694 T -> C LOC_Os03g62100.1 downstream_gene_variant ; 2729.0bp to feature; MODIFIER silent_mutation Average:49.767; most accessible tissue: Callus, score: 80.14 N N N N
vg0335186694 T -> C LOC_Os03g62090-LOC_Os03g62100 intergenic_region ; MODIFIER silent_mutation Average:49.767; most accessible tissue: Callus, score: 80.14 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0335186694 NA 7.79E-06 mr1099 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335186694 NA 4.80E-07 mr1180 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335186694 NA 9.62E-08 mr1095_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335186694 NA 1.03E-06 mr1099_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335186694 2.40E-06 NA mr1151_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335186694 NA 1.57E-06 mr1222_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335186694 NA 8.38E-12 mr1377_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335186694 NA 9.39E-06 mr1722_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335186694 NA 1.05E-06 mr1910_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251