\
| Variant ID: vg0335186610 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 35186610 |
| Reference Allele: G | Alternative Allele: T |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, T: 0.02, others allele: 0.00, population size: 120. )
GATCAGAATCTAACTGAGATCGAGCGACCCACTGTTTTTTTTTACTAATTTTTTTGAGGTAATTTTTTTTTACTAATTACTACTCCCACCGTTCCATATC[G/T]
CAAGTTATTTTAGTTTTAGTCAAAGTTTAATTTTAACTTTTTATCAAGTTTACAGAAAATTAAAGATATACCAATATTTTTAATAACATATAAACAAACT
AGTTTGTTTATATGTTATTAAAAATATTGGTATATCTTTAATTTTCTGTAAACTTGATAAAAAGTTAAAATTAAACTTTGACTAAAACTAAAATAACTTG[C/A]
GATATGGAACGGTGGGAGTAGTAATTAGTAAAAAAAAATTACCTCAAAAAAATTAGTAAAAAAAAACAGTGGGTCGCTCGATCTCAGTTAGATTCTGATC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 60.50% | 38.00% | 1.48% | 0.00% | NA |
| All Indica | 2759 | 50.30% | 48.40% | 1.30% | 0.00% | NA |
| All Japonica | 1512 | 70.20% | 27.80% | 1.98% | 0.00% | NA |
| Aus | 269 | 98.90% | 0.40% | 0.74% | 0.00% | NA |
| Indica I | 595 | 32.80% | 64.00% | 3.19% | 0.00% | NA |
| Indica II | 465 | 71.00% | 27.50% | 1.51% | 0.00% | NA |
| Indica III | 913 | 42.60% | 57.40% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 60.30% | 38.40% | 1.27% | 0.00% | NA |
| Temperate Japonica | 767 | 96.50% | 1.80% | 1.69% | 0.00% | NA |
| Tropical Japonica | 504 | 40.30% | 57.30% | 2.38% | 0.00% | NA |
| Japonica Intermediate | 241 | 49.00% | 49.00% | 2.07% | 0.00% | NA |
| VI/Aromatic | 96 | 87.50% | 12.50% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 66.70% | 31.10% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0335186610 | G -> T | LOC_Os03g62110.2 | upstream_gene_variant ; 4185.0bp to feature; MODIFIER | silent_mutation | Average:52.725; most accessible tissue: Minghui63 root, score: 69.846 | N | N | N | N |
| vg0335186610 | G -> T | LOC_Os03g62110.3 | upstream_gene_variant ; 4185.0bp to feature; MODIFIER | silent_mutation | Average:52.725; most accessible tissue: Minghui63 root, score: 69.846 | N | N | N | N |
| vg0335186610 | G -> T | LOC_Os03g62090.1 | downstream_gene_variant ; 3187.0bp to feature; MODIFIER | silent_mutation | Average:52.725; most accessible tissue: Minghui63 root, score: 69.846 | N | N | N | N |
| vg0335186610 | G -> T | LOC_Os03g62100.1 | downstream_gene_variant ; 2813.0bp to feature; MODIFIER | silent_mutation | Average:52.725; most accessible tissue: Minghui63 root, score: 69.846 | N | N | N | N |
| vg0335186610 | G -> T | LOC_Os03g62090-LOC_Os03g62100 | intergenic_region ; MODIFIER | silent_mutation | Average:52.725; most accessible tissue: Minghui63 root, score: 69.846 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0335186610 | NA | 2.69E-06 | mr1180 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0335186610 | NA | 1.47E-06 | mr1183 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0335186610 | NA | 5.34E-06 | mr1063_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0335186610 | NA | 1.19E-08 | mr1180_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0335186610 | NA | 4.26E-09 | mr1183_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0335186610 | NA | 1.41E-07 | mr1338_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0335186610 | NA | 2.15E-07 | mr1350_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0335186610 | NA | 2.21E-06 | mr1363_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0335186610 | NA | 8.97E-07 | mr1377_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0335186610 | NA | 2.71E-06 | mr1383_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0335186610 | NA | 8.16E-06 | mr1449_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0335186610 | NA | 2.34E-09 | mr1794_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0335186610 | NA | 2.18E-09 | mr1910_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |