\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0335186610:

Variant ID: vg0335186610 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 35186610
Reference Allele: GAlternative Allele: T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, T: 0.02, others allele: 0.00, population size: 120. )

Flanking Sequence (100 bp) in Reference Genome:


GATCAGAATCTAACTGAGATCGAGCGACCCACTGTTTTTTTTTACTAATTTTTTTGAGGTAATTTTTTTTTACTAATTACTACTCCCACCGTTCCATATC[G/T]
CAAGTTATTTTAGTTTTAGTCAAAGTTTAATTTTAACTTTTTATCAAGTTTACAGAAAATTAAAGATATACCAATATTTTTAATAACATATAAACAAACT

Reverse complement sequence

AGTTTGTTTATATGTTATTAAAAATATTGGTATATCTTTAATTTTCTGTAAACTTGATAAAAAGTTAAAATTAAACTTTGACTAAAACTAAAATAACTTG[C/A]
GATATGGAACGGTGGGAGTAGTAATTAGTAAAAAAAAATTACCTCAAAAAAATTAGTAAAAAAAAACAGTGGGTCGCTCGATCTCAGTTAGATTCTGATC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 60.50% 38.00% 1.48% 0.00% NA
All Indica  2759 50.30% 48.40% 1.30% 0.00% NA
All Japonica  1512 70.20% 27.80% 1.98% 0.00% NA
Aus  269 98.90% 0.40% 0.74% 0.00% NA
Indica I  595 32.80% 64.00% 3.19% 0.00% NA
Indica II  465 71.00% 27.50% 1.51% 0.00% NA
Indica III  913 42.60% 57.40% 0.00% 0.00% NA
Indica Intermediate  786 60.30% 38.40% 1.27% 0.00% NA
Temperate Japonica  767 96.50% 1.80% 1.69% 0.00% NA
Tropical Japonica  504 40.30% 57.30% 2.38% 0.00% NA
Japonica Intermediate  241 49.00% 49.00% 2.07% 0.00% NA
VI/Aromatic  96 87.50% 12.50% 0.00% 0.00% NA
Intermediate  90 66.70% 31.10% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0335186610 G -> T LOC_Os03g62110.2 upstream_gene_variant ; 4185.0bp to feature; MODIFIER silent_mutation Average:52.725; most accessible tissue: Minghui63 root, score: 69.846 N N N N
vg0335186610 G -> T LOC_Os03g62110.3 upstream_gene_variant ; 4185.0bp to feature; MODIFIER silent_mutation Average:52.725; most accessible tissue: Minghui63 root, score: 69.846 N N N N
vg0335186610 G -> T LOC_Os03g62090.1 downstream_gene_variant ; 3187.0bp to feature; MODIFIER silent_mutation Average:52.725; most accessible tissue: Minghui63 root, score: 69.846 N N N N
vg0335186610 G -> T LOC_Os03g62100.1 downstream_gene_variant ; 2813.0bp to feature; MODIFIER silent_mutation Average:52.725; most accessible tissue: Minghui63 root, score: 69.846 N N N N
vg0335186610 G -> T LOC_Os03g62090-LOC_Os03g62100 intergenic_region ; MODIFIER silent_mutation Average:52.725; most accessible tissue: Minghui63 root, score: 69.846 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0335186610 NA 2.69E-06 mr1180 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335186610 NA 1.47E-06 mr1183 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335186610 NA 5.34E-06 mr1063_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335186610 NA 1.19E-08 mr1180_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335186610 NA 4.26E-09 mr1183_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335186610 NA 1.41E-07 mr1338_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335186610 NA 2.15E-07 mr1350_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335186610 NA 2.21E-06 mr1363_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335186610 NA 8.97E-07 mr1377_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335186610 NA 2.71E-06 mr1383_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335186610 NA 8.16E-06 mr1449_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335186610 NA 2.34E-09 mr1794_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335186610 NA 2.18E-09 mr1910_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251