\
| Variant ID: vg0335145372 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 35145372 |
| Reference Allele: G | Alternative Allele: C |
| Primary Allele: G | Secondary Allele: C |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, C: 0.01, others allele: 0.00, population size: 116. )
AAGAAACCCAGCAGGACAATAAACTCTATAAGTTTTTAGATCCAATTTTTAAAGGTTCCAAGGAGAATGAACAAAGCTAATAAAAAATAATATGACAGAA[G/C]
TAAGGGGTAGCAACTGATGTGTCTTTTAAAAACTATAAAATTAGAAATATGAGGATGATAAGGTTTGATCTTTCAAAATCTTAAGACAACGAGATAACTA
TAGTTATCTCGTTGTCTTAAGATTTTGAAAGATCAAACCTTATCATCCTCATATTTCTAATTTTATAGTTTTTAAAAGACACATCAGTTGCTACCCCTTA[C/G]
TTCTGTCATATTATTTTTTATTAGCTTTGTTCATTCTCCTTGGAACCTTTAAAAATTGGATCTAAAAACTTATAGAGTTTATTGTCCTGCTGGGTTTCTT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 85.10% | 10.20% | 4.70% | 0.00% | NA |
| All Indica | 2759 | 75.40% | 16.90% | 7.72% | 0.00% | NA |
| All Japonica | 1512 | 99.70% | 0.20% | 0.13% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 83.90% | 11.60% | 4.54% | 0.00% | NA |
| Indica II | 465 | 51.00% | 32.30% | 16.77% | 0.00% | NA |
| Indica III | 913 | 85.90% | 10.80% | 3.29% | 0.00% | NA |
| Indica Intermediate | 786 | 71.10% | 19.00% | 9.92% | 0.00% | NA |
| Temperate Japonica | 767 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.60% | 0.20% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.00% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 97.90% | 1.00% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 82.20% | 11.10% | 6.67% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0335145372 | G -> C | LOC_Os03g62020.1 | upstream_gene_variant ; 262.0bp to feature; MODIFIER | silent_mutation | Average:39.684; most accessible tissue: Minghui63 panicle, score: 70.194 | N | N | N | N |
| vg0335145372 | G -> C | LOC_Os03g62040.1 | upstream_gene_variant ; 4966.0bp to feature; MODIFIER | silent_mutation | Average:39.684; most accessible tissue: Minghui63 panicle, score: 70.194 | N | N | N | N |
| vg0335145372 | G -> C | LOC_Os03g62010.1 | downstream_gene_variant ; 4156.0bp to feature; MODIFIER | silent_mutation | Average:39.684; most accessible tissue: Minghui63 panicle, score: 70.194 | N | N | N | N |
| vg0335145372 | G -> C | LOC_Os03g62030.1 | downstream_gene_variant ; 1869.0bp to feature; MODIFIER | silent_mutation | Average:39.684; most accessible tissue: Minghui63 panicle, score: 70.194 | N | N | N | N |
| vg0335145372 | G -> C | LOC_Os03g62030.3 | downstream_gene_variant ; 1869.0bp to feature; MODIFIER | silent_mutation | Average:39.684; most accessible tissue: Minghui63 panicle, score: 70.194 | N | N | N | N |
| vg0335145372 | G -> C | LOC_Os03g62030.4 | downstream_gene_variant ; 1869.0bp to feature; MODIFIER | silent_mutation | Average:39.684; most accessible tissue: Minghui63 panicle, score: 70.194 | N | N | N | N |
| vg0335145372 | G -> C | LOC_Os03g62030.2 | downstream_gene_variant ; 1869.0bp to feature; MODIFIER | silent_mutation | Average:39.684; most accessible tissue: Minghui63 panicle, score: 70.194 | N | N | N | N |
| vg0335145372 | G -> C | LOC_Os03g62030.5 | downstream_gene_variant ; 1869.0bp to feature; MODIFIER | silent_mutation | Average:39.684; most accessible tissue: Minghui63 panicle, score: 70.194 | N | N | N | N |
| vg0335145372 | G -> C | LOC_Os03g62030.6 | downstream_gene_variant ; 1869.0bp to feature; MODIFIER | silent_mutation | Average:39.684; most accessible tissue: Minghui63 panicle, score: 70.194 | N | N | N | N |
| vg0335145372 | G -> C | LOC_Os03g62010-LOC_Os03g62020 | intergenic_region ; MODIFIER | silent_mutation | Average:39.684; most accessible tissue: Minghui63 panicle, score: 70.194 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0335145372 | NA | 7.56E-06 | mr1098 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0335145372 | NA | 7.47E-06 | mr1918 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0335145372 | NA | 5.23E-07 | mr1428_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0335145372 | NA | 2.30E-06 | mr1428_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |