\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0335145372:

Variant ID: vg0335145372 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 35145372
Reference Allele: GAlternative Allele: C
Primary Allele: GSecondary Allele: C

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, C: 0.01, others allele: 0.00, population size: 116. )

Flanking Sequence (100 bp) in Reference Genome:


AAGAAACCCAGCAGGACAATAAACTCTATAAGTTTTTAGATCCAATTTTTAAAGGTTCCAAGGAGAATGAACAAAGCTAATAAAAAATAATATGACAGAA[G/C]
TAAGGGGTAGCAACTGATGTGTCTTTTAAAAACTATAAAATTAGAAATATGAGGATGATAAGGTTTGATCTTTCAAAATCTTAAGACAACGAGATAACTA

Reverse complement sequence

TAGTTATCTCGTTGTCTTAAGATTTTGAAAGATCAAACCTTATCATCCTCATATTTCTAATTTTATAGTTTTTAAAAGACACATCAGTTGCTACCCCTTA[C/G]
TTCTGTCATATTATTTTTTATTAGCTTTGTTCATTCTCCTTGGAACCTTTAAAAATTGGATCTAAAAACTTATAGAGTTTATTGTCCTGCTGGGTTTCTT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 85.10% 10.20% 4.70% 0.00% NA
All Indica  2759 75.40% 16.90% 7.72% 0.00% NA
All Japonica  1512 99.70% 0.20% 0.13% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 83.90% 11.60% 4.54% 0.00% NA
Indica II  465 51.00% 32.30% 16.77% 0.00% NA
Indica III  913 85.90% 10.80% 3.29% 0.00% NA
Indica Intermediate  786 71.10% 19.00% 9.92% 0.00% NA
Temperate Japonica  767 99.70% 0.30% 0.00% 0.00% NA
Tropical Japonica  504 99.60% 0.20% 0.20% 0.00% NA
Japonica Intermediate  241 99.60% 0.00% 0.41% 0.00% NA
VI/Aromatic  96 97.90% 1.00% 1.04% 0.00% NA
Intermediate  90 82.20% 11.10% 6.67% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0335145372 G -> C LOC_Os03g62020.1 upstream_gene_variant ; 262.0bp to feature; MODIFIER silent_mutation Average:39.684; most accessible tissue: Minghui63 panicle, score: 70.194 N N N N
vg0335145372 G -> C LOC_Os03g62040.1 upstream_gene_variant ; 4966.0bp to feature; MODIFIER silent_mutation Average:39.684; most accessible tissue: Minghui63 panicle, score: 70.194 N N N N
vg0335145372 G -> C LOC_Os03g62010.1 downstream_gene_variant ; 4156.0bp to feature; MODIFIER silent_mutation Average:39.684; most accessible tissue: Minghui63 panicle, score: 70.194 N N N N
vg0335145372 G -> C LOC_Os03g62030.1 downstream_gene_variant ; 1869.0bp to feature; MODIFIER silent_mutation Average:39.684; most accessible tissue: Minghui63 panicle, score: 70.194 N N N N
vg0335145372 G -> C LOC_Os03g62030.3 downstream_gene_variant ; 1869.0bp to feature; MODIFIER silent_mutation Average:39.684; most accessible tissue: Minghui63 panicle, score: 70.194 N N N N
vg0335145372 G -> C LOC_Os03g62030.4 downstream_gene_variant ; 1869.0bp to feature; MODIFIER silent_mutation Average:39.684; most accessible tissue: Minghui63 panicle, score: 70.194 N N N N
vg0335145372 G -> C LOC_Os03g62030.2 downstream_gene_variant ; 1869.0bp to feature; MODIFIER silent_mutation Average:39.684; most accessible tissue: Minghui63 panicle, score: 70.194 N N N N
vg0335145372 G -> C LOC_Os03g62030.5 downstream_gene_variant ; 1869.0bp to feature; MODIFIER silent_mutation Average:39.684; most accessible tissue: Minghui63 panicle, score: 70.194 N N N N
vg0335145372 G -> C LOC_Os03g62030.6 downstream_gene_variant ; 1869.0bp to feature; MODIFIER silent_mutation Average:39.684; most accessible tissue: Minghui63 panicle, score: 70.194 N N N N
vg0335145372 G -> C LOC_Os03g62010-LOC_Os03g62020 intergenic_region ; MODIFIER silent_mutation Average:39.684; most accessible tissue: Minghui63 panicle, score: 70.194 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0335145372 NA 7.56E-06 mr1098 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335145372 NA 7.47E-06 mr1918 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335145372 NA 5.23E-07 mr1428_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335145372 NA 2.30E-06 mr1428_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251