\
| Variant ID: vg0335139941 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 35139941 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
AAAAAATAGAACCTAGCCCCATCGTCACTTATAATTTATGAATAAAACTTTTAGATATGTGTTCTTAGCGATCTAAAAGCAAAGTCTGAAAAATAAATTT[T/C]
GATGAAAAAACCTTAAAATTAACTCCAAATTTAAAGTTAGAAATTTAAATTTTGGCTGATAAGTATAAGTATAAGTGAAAAGGATGTCATGTTTTTTATG
CATAAAAAACATGACATCCTTTTCACTTATACTTATACTTATCAGCCAAAATTTAAATTTCTAACTTTAAATTTGGAGTTAATTTTAAGGTTTTTTCATC[A/G]
AAATTTATTTTTCAGACTTTGCTTTTAGATCGCTAAGAACACATATCTAAAAGTTTTATTCATAAATTATAAGTGACGATGGGGCTAGGTTCTATTTTTT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 81.50% | 13.80% | 4.66% | 0.00% | NA |
| All Indica | 2759 | 94.40% | 2.10% | 3.44% | 0.00% | NA |
| All Japonica | 1512 | 53.70% | 38.50% | 7.80% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.00% | 0.37% | 0.00% | NA |
| Indica I | 595 | 84.00% | 5.70% | 10.25% | 0.00% | NA |
| Indica II | 465 | 95.90% | 2.60% | 1.51% | 0.00% | NA |
| Indica III | 913 | 99.70% | 0.20% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 95.30% | 1.40% | 3.31% | 0.00% | NA |
| Temperate Japonica | 767 | 27.40% | 62.10% | 10.56% | 0.00% | NA |
| Tropical Japonica | 504 | 89.50% | 6.90% | 3.57% | 0.00% | NA |
| Japonica Intermediate | 241 | 62.70% | 29.50% | 7.88% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 0.00% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 82.20% | 12.20% | 5.56% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0335139941 | T -> C | LOC_Os03g61990.1 | upstream_gene_variant ; 2596.0bp to feature; MODIFIER | silent_mutation | Average:73.927; most accessible tissue: Callus, score: 91.575 | N | N | N | N |
| vg0335139941 | T -> C | LOC_Os03g62000.1 | upstream_gene_variant ; 1069.0bp to feature; MODIFIER | silent_mutation | Average:73.927; most accessible tissue: Callus, score: 91.575 | N | N | N | N |
| vg0335139941 | T -> C | LOC_Os03g62010.1 | upstream_gene_variant ; 254.0bp to feature; MODIFIER | silent_mutation | Average:73.927; most accessible tissue: Callus, score: 91.575 | N | N | N | N |
| vg0335139941 | T -> C | LOC_Os03g61990.5 | upstream_gene_variant ; 2614.0bp to feature; MODIFIER | silent_mutation | Average:73.927; most accessible tissue: Callus, score: 91.575 | N | N | N | N |
| vg0335139941 | T -> C | LOC_Os03g61990.2 | upstream_gene_variant ; 2596.0bp to feature; MODIFIER | silent_mutation | Average:73.927; most accessible tissue: Callus, score: 91.575 | N | N | N | N |
| vg0335139941 | T -> C | LOC_Os03g61990.3 | upstream_gene_variant ; 2614.0bp to feature; MODIFIER | silent_mutation | Average:73.927; most accessible tissue: Callus, score: 91.575 | N | N | N | N |
| vg0335139941 | T -> C | LOC_Os03g61990.4 | upstream_gene_variant ; 2596.0bp to feature; MODIFIER | silent_mutation | Average:73.927; most accessible tissue: Callus, score: 91.575 | N | N | N | N |
| vg0335139941 | T -> C | LOC_Os03g62000-LOC_Os03g62010 | intergenic_region ; MODIFIER | silent_mutation | Average:73.927; most accessible tissue: Callus, score: 91.575 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0335139941 | NA | 4.18E-13 | Plant_height | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0335139941 | NA | 6.67E-10 | mr1002 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0335139941 | NA | 1.45E-08 | mr1002 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0335139941 | 1.47E-08 | 2.12E-15 | mr1002_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0335139941 | 2.60E-07 | 1.38E-12 | mr1002_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0335139941 | NA | 3.22E-14 | mr1182_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0335139941 | NA | 5.61E-07 | mr1182_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0335139941 | NA | 2.31E-11 | mr1282_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0335139941 | NA | 7.39E-06 | mr1282_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |