\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0335139941:

Variant ID: vg0335139941 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 35139941
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AAAAAATAGAACCTAGCCCCATCGTCACTTATAATTTATGAATAAAACTTTTAGATATGTGTTCTTAGCGATCTAAAAGCAAAGTCTGAAAAATAAATTT[T/C]
GATGAAAAAACCTTAAAATTAACTCCAAATTTAAAGTTAGAAATTTAAATTTTGGCTGATAAGTATAAGTATAAGTGAAAAGGATGTCATGTTTTTTATG

Reverse complement sequence

CATAAAAAACATGACATCCTTTTCACTTATACTTATACTTATCAGCCAAAATTTAAATTTCTAACTTTAAATTTGGAGTTAATTTTAAGGTTTTTTCATC[A/G]
AAATTTATTTTTCAGACTTTGCTTTTAGATCGCTAAGAACACATATCTAAAAGTTTTATTCATAAATTATAAGTGACGATGGGGCTAGGTTCTATTTTTT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 81.50% 13.80% 4.66% 0.00% NA
All Indica  2759 94.40% 2.10% 3.44% 0.00% NA
All Japonica  1512 53.70% 38.50% 7.80% 0.00% NA
Aus  269 99.60% 0.00% 0.37% 0.00% NA
Indica I  595 84.00% 5.70% 10.25% 0.00% NA
Indica II  465 95.90% 2.60% 1.51% 0.00% NA
Indica III  913 99.70% 0.20% 0.11% 0.00% NA
Indica Intermediate  786 95.30% 1.40% 3.31% 0.00% NA
Temperate Japonica  767 27.40% 62.10% 10.56% 0.00% NA
Tropical Japonica  504 89.50% 6.90% 3.57% 0.00% NA
Japonica Intermediate  241 62.70% 29.50% 7.88% 0.00% NA
VI/Aromatic  96 99.00% 0.00% 1.04% 0.00% NA
Intermediate  90 82.20% 12.20% 5.56% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0335139941 T -> C LOC_Os03g61990.1 upstream_gene_variant ; 2596.0bp to feature; MODIFIER silent_mutation Average:73.927; most accessible tissue: Callus, score: 91.575 N N N N
vg0335139941 T -> C LOC_Os03g62000.1 upstream_gene_variant ; 1069.0bp to feature; MODIFIER silent_mutation Average:73.927; most accessible tissue: Callus, score: 91.575 N N N N
vg0335139941 T -> C LOC_Os03g62010.1 upstream_gene_variant ; 254.0bp to feature; MODIFIER silent_mutation Average:73.927; most accessible tissue: Callus, score: 91.575 N N N N
vg0335139941 T -> C LOC_Os03g61990.5 upstream_gene_variant ; 2614.0bp to feature; MODIFIER silent_mutation Average:73.927; most accessible tissue: Callus, score: 91.575 N N N N
vg0335139941 T -> C LOC_Os03g61990.2 upstream_gene_variant ; 2596.0bp to feature; MODIFIER silent_mutation Average:73.927; most accessible tissue: Callus, score: 91.575 N N N N
vg0335139941 T -> C LOC_Os03g61990.3 upstream_gene_variant ; 2614.0bp to feature; MODIFIER silent_mutation Average:73.927; most accessible tissue: Callus, score: 91.575 N N N N
vg0335139941 T -> C LOC_Os03g61990.4 upstream_gene_variant ; 2596.0bp to feature; MODIFIER silent_mutation Average:73.927; most accessible tissue: Callus, score: 91.575 N N N N
vg0335139941 T -> C LOC_Os03g62000-LOC_Os03g62010 intergenic_region ; MODIFIER silent_mutation Average:73.927; most accessible tissue: Callus, score: 91.575 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0335139941 NA 4.18E-13 Plant_height Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0335139941 NA 6.67E-10 mr1002 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335139941 NA 1.45E-08 mr1002 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335139941 1.47E-08 2.12E-15 mr1002_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335139941 2.60E-07 1.38E-12 mr1002_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335139941 NA 3.22E-14 mr1182_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335139941 NA 5.61E-07 mr1182_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335139941 NA 2.31E-11 mr1282_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335139941 NA 7.39E-06 mr1282_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251