\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0335027666:

Variant ID: vg0335027666 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 35027666
Reference Allele: GAlternative Allele: A,T
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CGTCAACATCAACCCAAGTAATTATTCATTTTACTTCGTCTGTTTTATATTATAAGACTTTATAGCATTGTCCACATTCATTTATATGTTAATGAATTTA[G/A,T]
ACATATATATGTATTCATTAATATTTATATGAATATGAGTAATGGAACGTCTTATAATATGAAACAAACGAAGGGAGTATTAATTAACCCCACTAAACCT

Reverse complement sequence

AGGTTTAGTGGGGTTAATTAATACTCCCTTCGTTTGTTTCATATTATAAGACGTTCCATTACTCATATTCATATAAATATTAATGAATACATATATATGT[C/T,A]
TAAATTCATTAACATATAAATGAATGTGGACAATGCTATAAAGTCTTATAATATAAAACAGACGAAGTAAAATGAATAATTACTTGGGTTGATGTTGACG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 84.80% 7.60% 7.26% 0.02% T: 0.23%
All Indica  2759 88.60% 4.80% 6.20% 0.04% T: 0.33%
All Japonica  1512 90.30% 6.20% 3.51% 0.00% NA
Aus  269 11.90% 44.60% 42.75% 0.00% T: 0.74%
Indica I  595 90.60% 4.20% 4.87% 0.00% T: 0.34%
Indica II  465 94.20% 0.60% 4.95% 0.22% NA
Indica III  913 88.20% 5.60% 5.81% 0.00% T: 0.44%
Indica Intermediate  786 84.40% 6.90% 8.40% 0.00% T: 0.38%
Temperate Japonica  767 86.80% 7.40% 5.74% 0.00% NA
Tropical Japonica  504 95.60% 3.80% 0.60% 0.00% NA
Japonica Intermediate  241 90.50% 7.10% 2.49% 0.00% NA
VI/Aromatic  96 88.50% 11.50% 0.00% 0.00% NA
Intermediate  90 91.10% 4.40% 4.44% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0335027666 G -> T LOC_Os03g61790.1 downstream_gene_variant ; 1318.0bp to feature; MODIFIER silent_mutation Average:88.782; most accessible tissue: Zhenshan97 panicle, score: 96.335 N N N N
vg0335027666 G -> T LOC_Os03g61790.2 downstream_gene_variant ; 1318.0bp to feature; MODIFIER silent_mutation Average:88.782; most accessible tissue: Zhenshan97 panicle, score: 96.335 N N N N
vg0335027666 G -> T LOC_Os03g61780.1 intron_variant ; MODIFIER silent_mutation Average:88.782; most accessible tissue: Zhenshan97 panicle, score: 96.335 N N N N
vg0335027666 G -> T LOC_Os03g61780.2 intron_variant ; MODIFIER silent_mutation Average:88.782; most accessible tissue: Zhenshan97 panicle, score: 96.335 N N N N
vg0335027666 G -> A LOC_Os03g61790.1 downstream_gene_variant ; 1318.0bp to feature; MODIFIER silent_mutation Average:88.782; most accessible tissue: Zhenshan97 panicle, score: 96.335 N N N N
vg0335027666 G -> A LOC_Os03g61790.2 downstream_gene_variant ; 1318.0bp to feature; MODIFIER silent_mutation Average:88.782; most accessible tissue: Zhenshan97 panicle, score: 96.335 N N N N
vg0335027666 G -> A LOC_Os03g61780.1 intron_variant ; MODIFIER silent_mutation Average:88.782; most accessible tissue: Zhenshan97 panicle, score: 96.335 N N N N
vg0335027666 G -> A LOC_Os03g61780.2 intron_variant ; MODIFIER silent_mutation Average:88.782; most accessible tissue: Zhenshan97 panicle, score: 96.335 N N N N
vg0335027666 G -> DEL N N silent_mutation Average:88.782; most accessible tissue: Zhenshan97 panicle, score: 96.335 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0335027666 G A -0.01 -0.01 -0.02 -0.01 -0.02 -0.02
vg0335027666 G T 0.0 0.0 0.0 -0.01 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0335027666 1.59E-07 1.59E-07 mr1024 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335027666 NA 8.67E-07 mr1565 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335027666 9.29E-10 9.29E-10 mr1024_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335027666 4.99E-08 2.21E-11 mr1565_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335027666 1.57E-06 1.57E-06 mr1915_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335027666 7.63E-07 7.63E-07 mr1940_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251