Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0335018170:

Variant ID: vg0335018170 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 35018170
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.01, others allele: 0.00, population size: 277. )

Flanking Sequence (100 bp) in Reference Genome:

GTGTCTTATTTTAAGGAGAAAACGAGACTAAACCTTACAATGCACAGTTAATTAGGGAAAAACTGGACGAAAACCACAACACTCTAACCTAAGCTACCAA[T/C]
ACCATGGAAAAAGGAAAAATGGCGGAGCCCAAAACAGCTATCGATAAAGAGCTTGTTGTAAGCGATACAAAGGCTTCGACTTCGTGAGGCAAATGTTATC

Reverse complement sequence

GATAACATTTGCCTCACGAAGTCGAAGCCTTTGTATCGCTTACAACAAGCTCTTTATCGATAGCTGTTTTGGGCTCCGCCATTTTTCCTTTTTCCATGGT[A/G]
TTGGTAGCTTAGGTTAGAGTGTTGTGGTTTTCGTCCAGTTTTTCCCTAATTAACTGTGCATTGTAAGGTTTAGTCTCGTTTTCTCCTTAAAATAAGACAC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	82.60%	13.90%	3.45%	0.00%	NA
All Indica	2759	95.70%	1.80%	2.57%	0.00%	NA
All Japonica	1512	54.40%	39.70%	5.89%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	85.90%	5.00%	9.08%	0.00%	NA
Indica II	465	97.60%	1.70%	0.65%	0.00%	NA
Indica III	913	99.90%	0.10%	0.00%	0.00%	NA
Indica Intermediate	786	96.90%	1.30%	1.78%	0.00%	NA
Temperate Japonica	767	29.70%	61.80%	8.47%	0.00%	NA
Tropical Japonica	504	87.10%	10.50%	2.38%	0.00%	NA
Japonica Intermediate	241	64.70%	30.30%	4.98%	0.00%	NA
VI/Aromatic	96	99.00%	0.00%	1.04%	0.00%	NA
Intermediate	90	87.80%	10.00%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0335018170	T -> C	LOC_Os03g61760.1	upstream_gene_variant ; 2440.0bp to feature; MODIFIER	silent_mutation	Average:51.731; most accessible tissue: Zhenshan97 panicle, score: 78.302	N	N	N	N
vg0335018170	T -> C	LOC_Os03g61770.1	upstream_gene_variant ; 19.0bp to feature; MODIFIER	silent_mutation	Average:51.731; most accessible tissue: Zhenshan97 panicle, score: 78.302	N	N	N	N
vg0335018170	T -> C	LOC_Os03g61760-LOC_Os03g61770	intergenic_region ; MODIFIER	silent_mutation	Average:51.731; most accessible tissue: Zhenshan97 panicle, score: 78.302	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0335018170	NA	2.44E-15	Plant_height	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0335018170	NA	2.47E-09	mr1002	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335018170	NA	1.41E-07	mr1002	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335018170	NA	6.52E-07	mr1227	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335018170	NA	3.91E-06	mr1942	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335018170	4.48E-08	5.55E-16	mr1002_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335018170	6.66E-06	4.60E-13	mr1002_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335018170	3.60E-06	NA	mr1024_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335018170	NA	4.91E-13	mr1182_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335018170	NA	5.61E-06	mr1182_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335018170	NA	3.39E-06	mr1227_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335018170	NA	5.75E-10	mr1282_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335018170	NA	1.24E-06	mr1647_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335018170	3.76E-07	8.20E-09	mr1648_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335018170	NA	3.23E-09	mr1794_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335018170	NA	9.72E-09	mr1940_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335018170	NA	1.82E-06	mr1977_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251