\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0335000939:

Variant ID: vg0335000939 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 35000939
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.66, A: 0.34, others allele: 0.00, population size: 250. )

Flanking Sequence (100 bp) in Reference Genome:


TATACGTTGTCGCTGCTGACATAAGTGGCAAGGCAAAGAACCTGTGTTCATAGGATAATAAATCCCACAGCTATTTGATCAAGACGTGTCAAGGTAGTTA[G/A]
CCTCAATGATTTTTCTAAATGGTCCTAGCTTAACCGATTTTTGGACATATCGAAGATAATATCAACAACACTGTGTAAATAGTTACTATGTCTACGTATA

Reverse complement sequence

TATACGTAGACATAGTAACTATTTACACAGTGTTGTTGATATTATCTTCGATATGTCCAAAAATCGGTTAAGCTAGGACCATTTAGAAAAATCATTGAGG[C/T]
TAACTACCTTGACACGTCTTGATCAAATAGCTGTGGGATTTATTATCCTATGAACACAGGTTCTTTGCCTTGCCACTTATGTCAGCAGCGACAACGTATA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 87.80% 12.00% 0.19% 0.00% NA
All Indica  2759 88.20% 11.50% 0.33% 0.00% NA
All Japonica  1512 98.50% 1.50% 0.00% 0.00% NA
Aus  269 22.70% 77.30% 0.00% 0.00% NA
Indica I  595 97.30% 2.20% 0.50% 0.00% NA
Indica II  465 92.00% 7.10% 0.86% 0.00% NA
Indica III  913 80.60% 19.30% 0.11% 0.00% NA
Indica Intermediate  786 87.80% 12.10% 0.13% 0.00% NA
Temperate Japonica  767 99.70% 0.30% 0.00% 0.00% NA
Tropical Japonica  504 96.60% 3.40% 0.00% 0.00% NA
Japonica Intermediate  241 98.80% 1.20% 0.00% 0.00% NA
VI/Aromatic  96 84.40% 15.60% 0.00% 0.00% NA
Intermediate  90 94.40% 5.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0335000939 G -> A LOC_Os03g61730.1 upstream_gene_variant ; 3209.0bp to feature; MODIFIER silent_mutation Average:53.335; most accessible tissue: Callus, score: 89.813 N N N N
vg0335000939 G -> A LOC_Os03g61740.1 upstream_gene_variant ; 1659.0bp to feature; MODIFIER silent_mutation Average:53.335; most accessible tissue: Callus, score: 89.813 N N N N
vg0335000939 G -> A LOC_Os03g61750.1 upstream_gene_variant ; 3599.0bp to feature; MODIFIER silent_mutation Average:53.335; most accessible tissue: Callus, score: 89.813 N N N N
vg0335000939 G -> A LOC_Os03g61730-LOC_Os03g61740 intergenic_region ; MODIFIER silent_mutation Average:53.335; most accessible tissue: Callus, score: 89.813 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0335000939 NA 6.96E-15 mr1166 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335000939 4.93E-07 9.87E-25 mr1210 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335000939 4.24E-06 2.22E-06 mr1210 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335000939 6.91E-07 6.21E-27 mr1305 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335000939 6.81E-07 1.15E-07 mr1305 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335000939 4.29E-06 4.29E-06 mr1379 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335000939 1.56E-07 1.65E-14 mr1409 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335000939 9.57E-06 8.24E-21 mr1515 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335000939 3.49E-07 1.51E-07 mr1559 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335000939 NA 3.93E-25 mr1586 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335000939 NA 7.94E-06 mr1586 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335000939 NA 1.87E-09 mr1722 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335000939 6.42E-06 3.65E-19 mr1765 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335000939 2.07E-06 6.05E-06 mr1765 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335000939 NA 3.63E-20 mr1095_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335000939 3.34E-07 4.51E-13 mr1166_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335000939 1.06E-06 1.06E-06 mr1166_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335000939 2.62E-11 9.49E-31 mr1305_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335000939 6.83E-09 4.39E-10 mr1305_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335000939 2.91E-10 9.41E-19 mr1409_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335000939 5.94E-07 5.90E-07 mr1409_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335000939 8.27E-11 1.03E-14 mr1649_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335000939 1.31E-07 1.02E-06 mr1649_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335000939 1.08E-08 1.43E-12 mr1765_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335000939 1.76E-07 1.76E-07 mr1765_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0335000939 NA 3.89E-06 mr1815_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251