Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0334986236:

Variant ID: vg0334986236 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 34986236
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GTATATGATTTGCCACTTCAATTCAAATTCAACTTATATAGATAAAAACAAAAATAATAAATTTAACTACGAAGTGAACACGTAATTCATAGTCAAATTT[G/A]
TTATTTTTGTTTTATATTATATAAGTTGAATTTTAACTAATATGTTTACGAAAAGATATATTATATAGTGATCTATCTTAAAAGTATTTTTTAAAACTAT

Reverse complement sequence

ATAGTTTTAAAAAATACTTTTAAGATAGATCACTATATAATATATCTTTTCGTAAACATATTAGTTAAAATTCAACTTATATAATATAAAACAAAAATAA[C/T]
AAATTTGACTATGAATTACGTGTTCACTTCGTAGTTAAATTTATTATTTTTGTTTTTATCTATATAAGTTGAATTTGAATTGAAGTGGCAAATCATATAC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 90.60% 9.10% 0.21% 0.00% NA
All Indica  2759 89.50% 10.10% 0.36% 0.00% NA
All Japonica  1512 99.90% 0.10% 0.00% 0.00% NA
Aus  269 46.50% 53.50% 0.00% 0.00% NA
Indica I  595 97.50% 2.20% 0.34% 0.00% NA
Indica II  465 92.30% 6.70% 1.08% 0.00% NA
Indica III  913 81.60% 18.40% 0.00% 0.00% NA
Indica Intermediate  786 91.10% 8.50% 0.38% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 95.80% 4.20% 0.00% 0.00% NA
Intermediate  90 95.60% 4.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0334986236 G -> A LOC_Os03g61720.1 intron_variant ; MODIFIER silent_mutation Average:56.881; most accessible tissue: Callus, score: 95.342 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0334986236 2.00E-06 NA mr1210 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334986236 2.30E-06 1.44E-06 mr1210 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334986236 1.68E-06 NA mr1305 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334986236 4.70E-07 6.93E-08 mr1305 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334986236 7.03E-06 7.03E-06 mr1379 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334986236 5.15E-07 3.72E-13 mr1409 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334986236 6.49E-06 NA mr1515 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334986236 1.96E-06 5.39E-07 mr1559 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334986236 NA 7.87E-06 mr1586 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334986236 1.27E-06 4.63E-18 mr1765 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334986236 1.56E-06 5.82E-06 mr1765 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334986236 NA 2.02E-06 mr1117_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334986236 NA 5.67E-06 mr1120_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334986236 NA 8.66E-06 mr1123_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334986236 3.65E-06 3.79E-11 mr1166_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334986236 1.09E-06 1.09E-06 mr1166_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334986236 NA 7.78E-06 mr1247_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334986236 5.15E-10 4.48E-25 mr1305_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334986236 3.77E-09 2.28E-10 mr1305_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334986236 1.50E-08 3.70E-16 mr1409_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334986236 5.23E-07 5.82E-07 mr1409_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334986236 1.00E-08 2.38E-12 mr1649_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334986236 8.11E-08 6.22E-07 mr1649_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334986236 NA 1.06E-06 mr1762_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334986236 1.14E-07 1.24E-11 mr1765_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334986236 9.42E-08 9.42E-08 mr1765_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251