| Variant ID: vg0334873774 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr03 | Position: 34873774 |
| Reference Allele: GA | Alternative Allele: G,GAA,AA,GAAA |
| Primary Allele: GA | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
TAATAATTTATCTGGACAGCTCTTCACACTCACTACCTCCGTCTCAAAATAAGCTTATTTGTGAGTTTTTATGTTCAACATTTGACCGTCCGTCTTATTT[GA/G,GAA,AA,GAAA]
AAAAAAAAAGTAAAATAAGTCACGCGTAAAGTACTATTCATATTTTATCATCTAATAACAATAAAAATACTAATCATAAAAAAATTAAATAAAATGAATT
AATTCATTTTATTTAATTTTTTTATGATTAGTATTTTTATTGTTATTAGATGATAAAATATGAATAGTACTTTACGCGTGACTTATTTTACTTTTTTTTT[TC/C,TTC,TT,TTTC]
AAATAAGACGGACGGTCAAATGTTGAACATAAAAACTCACAAATAAGCTTATTTTGAGACGGAGGTAGTGAGTGTGAAGAGCTGTCCAGATAAATTATTA
| Populations | Population Size | Frequency of GA(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 69.60% | 3.10% | 3.51% | 20.14% | AA: 2.07%; GAA: 1.38%; GAAA: 0.15% |
| All Indica | 2759 | 60.30% | 2.90% | 1.41% | 33.74% | AA: 1.38%; GAA: 0.18%; GAAA: 0.04% |
| All Japonica | 1512 | 85.50% | 4.20% | 6.15% | 0.33% | AA: 3.84% |
| Aus | 269 | 65.40% | 0.40% | 10.41% | 0.00% | GAA: 21.19%; GAAA: 2.23%; AA: 0.37% |
| Indica I | 595 | 78.80% | 5.70% | 1.18% | 13.95% | AA: 0.34% |
| Indica II | 465 | 41.30% | 2.60% | 1.94% | 54.19% | NA |
| Indica III | 913 | 60.80% | 0.20% | 0.66% | 37.24% | AA: 1.10% |
| Indica Intermediate | 786 | 57.00% | 4.20% | 2.16% | 32.57% | AA: 3.31%; GAA: 0.64%; GAAA: 0.13% |
| Temperate Japonica | 767 | 83.20% | 6.50% | 9.13% | 0.26% | AA: 0.91% |
| Tropical Japonica | 504 | 93.10% | 1.00% | 1.98% | 0.60% | AA: 3.37% |
| Japonica Intermediate | 241 | 77.20% | 3.30% | 5.39% | 0.00% | AA: 14.11% |
| VI/Aromatic | 96 | 97.90% | 0.00% | 0.00% | 0.00% | GAA: 2.08% |
| Intermediate | 90 | 70.00% | 3.30% | 6.67% | 17.78% | AA: 1.11%; GAA: 1.11% |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0334873774 | GA -> GAA | LOC_Os03g61470.1 | upstream_gene_variant ; 2422.0bp to feature; MODIFIER | silent_mutation | Average:44.301; most accessible tissue: Minghui63 panicle, score: 88.281 | N | N | N | N |
| vg0334873774 | GA -> GAA | LOC_Os03g61480.1 | downstream_gene_variant ; 134.0bp to feature; MODIFIER | silent_mutation | Average:44.301; most accessible tissue: Minghui63 panicle, score: 88.281 | N | N | N | N |
| vg0334873774 | GA -> GAA | LOC_Os03g61490.1 | downstream_gene_variant ; 4267.0bp to feature; MODIFIER | silent_mutation | Average:44.301; most accessible tissue: Minghui63 panicle, score: 88.281 | N | N | N | N |
| vg0334873774 | GA -> GAA | LOC_Os03g61470-LOC_Os03g61480 | intergenic_region ; MODIFIER | silent_mutation | Average:44.301; most accessible tissue: Minghui63 panicle, score: 88.281 | N | N | N | N |
| vg0334873774 | GA -> DEL | N | N | silent_mutation | Average:44.301; most accessible tissue: Minghui63 panicle, score: 88.281 | N | N | N | N |
| vg0334873774 | GA -> G | LOC_Os03g61470.1 | upstream_gene_variant ; 2421.0bp to feature; MODIFIER | silent_mutation | Average:44.301; most accessible tissue: Minghui63 panicle, score: 88.281 | N | N | N | N |
| vg0334873774 | GA -> G | LOC_Os03g61480.1 | downstream_gene_variant ; 135.0bp to feature; MODIFIER | silent_mutation | Average:44.301; most accessible tissue: Minghui63 panicle, score: 88.281 | N | N | N | N |
| vg0334873774 | GA -> G | LOC_Os03g61490.1 | downstream_gene_variant ; 4268.0bp to feature; MODIFIER | silent_mutation | Average:44.301; most accessible tissue: Minghui63 panicle, score: 88.281 | N | N | N | N |
| vg0334873774 | GA -> G | LOC_Os03g61470-LOC_Os03g61480 | intergenic_region ; MODIFIER | silent_mutation | Average:44.301; most accessible tissue: Minghui63 panicle, score: 88.281 | N | N | N | N |
| vg0334873774 | GA -> AA | LOC_Os03g61470.1 | upstream_gene_variant ; 2420.0bp to feature; MODIFIER | silent_mutation | Average:44.301; most accessible tissue: Minghui63 panicle, score: 88.281 | N | N | N | N |
| vg0334873774 | GA -> AA | LOC_Os03g61480.1 | downstream_gene_variant ; 136.0bp to feature; MODIFIER | silent_mutation | Average:44.301; most accessible tissue: Minghui63 panicle, score: 88.281 | N | N | N | N |
| vg0334873774 | GA -> AA | LOC_Os03g61490.1 | downstream_gene_variant ; 4269.0bp to feature; MODIFIER | silent_mutation | Average:44.301; most accessible tissue: Minghui63 panicle, score: 88.281 | N | N | N | N |
| vg0334873774 | GA -> AA | LOC_Os03g61470-LOC_Os03g61480 | intergenic_region ; MODIFIER | silent_mutation | Average:44.301; most accessible tissue: Minghui63 panicle, score: 88.281 | N | N | N | N |
| vg0334873774 | GA -> GAAA | LOC_Os03g61470.1 | upstream_gene_variant ; 2422.0bp to feature; MODIFIER | silent_mutation | Average:44.301; most accessible tissue: Minghui63 panicle, score: 88.281 | N | N | N | N |
| vg0334873774 | GA -> GAAA | LOC_Os03g61480.1 | downstream_gene_variant ; 134.0bp to feature; MODIFIER | silent_mutation | Average:44.301; most accessible tissue: Minghui63 panicle, score: 88.281 | N | N | N | N |
| vg0334873774 | GA -> GAAA | LOC_Os03g61490.1 | downstream_gene_variant ; 4267.0bp to feature; MODIFIER | silent_mutation | Average:44.301; most accessible tissue: Minghui63 panicle, score: 88.281 | N | N | N | N |
| vg0334873774 | GA -> GAAA | LOC_Os03g61470-LOC_Os03g61480 | intergenic_region ; MODIFIER | silent_mutation | Average:44.301; most accessible tissue: Minghui63 panicle, score: 88.281 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0334873774 | 7.65E-06 | 7.45E-08 | mr1114 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0334873774 | NA | 2.58E-06 | mr1116 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0334873774 | 1.30E-06 | 1.18E-09 | mr1117 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0334873774 | NA | 3.15E-07 | mr1118 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0334873774 | NA | 8.28E-06 | mr1119 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0334873774 | NA | 6.64E-07 | mr1123 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0334873774 | NA | 1.44E-07 | mr1242 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0334873774 | NA | 1.56E-06 | mr1247 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0334873774 | 4.50E-06 | 9.48E-09 | mr1496 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0334873774 | NA | 8.50E-07 | mr1691 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/