\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0334859631:

Variant ID: vg0334859631 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 34859631
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTTATTTTTGATTTTTTATTATTTCTAATTATATTTATATGTGGACTCTAAACTCATCTCTCAATATTCTTTAATTTTGAATTTCAGTTACTTCTAAATT[A/G]
TATTCCTATATTGACTTTAAACTCTTCTTCCCATGTTTTTCTTAATTTTGAATTTTAGTTATTTGTAAATTGTATTTTTATACAGACTCAAAACTCTACT

Reverse complement sequence

AGTAGAGTTTTGAGTCTGTATAAAAATACAATTTACAAATAACTAAAATTCAAAATTAAGAAAAACATGGGAAGAAGAGTTTAAAGTCAATATAGGAATA[T/C]
AATTTAGAAGTAACTGAAATTCAAAATTAAAGAATATTGAGAGATGAGTTTAGAGTCCACATATAAATATAATTAGAAATAATAAAAAATCAAAAATAAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 49.00% 48.30% 2.12% 0.66% NA
All Indica  2759 80.20% 15.50% 3.23% 1.05% NA
All Japonica  1512 0.90% 98.90% 0.13% 0.00% NA
Aus  269 19.00% 78.40% 2.23% 0.37% NA
Indica I  595 89.20% 4.50% 5.88% 0.34% NA
Indica II  465 75.70% 15.50% 5.16% 3.66% NA
Indica III  913 81.10% 17.40% 1.20% 0.33% NA
Indica Intermediate  786 74.90% 21.80% 2.42% 0.89% NA
Temperate Japonica  767 0.70% 99.30% 0.00% 0.00% NA
Tropical Japonica  504 1.60% 98.20% 0.20% 0.00% NA
Japonica Intermediate  241 0.40% 99.20% 0.41% 0.00% NA
VI/Aromatic  96 5.20% 94.80% 0.00% 0.00% NA
Intermediate  90 35.60% 60.00% 3.33% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0334859631 A -> DEL N N silent_mutation Average:16.807; most accessible tissue: Zhenshan97 panicle, score: 28.447 N N N N
vg0334859631 A -> G LOC_Os03g61430.1 upstream_gene_variant ; 1747.0bp to feature; MODIFIER silent_mutation Average:16.807; most accessible tissue: Zhenshan97 panicle, score: 28.447 N N N N
vg0334859631 A -> G LOC_Os03g61450.1 upstream_gene_variant ; 4642.0bp to feature; MODIFIER silent_mutation Average:16.807; most accessible tissue: Zhenshan97 panicle, score: 28.447 N N N N
vg0334859631 A -> G LOC_Os03g61440.1 downstream_gene_variant ; 1129.0bp to feature; MODIFIER silent_mutation Average:16.807; most accessible tissue: Zhenshan97 panicle, score: 28.447 N N N N
vg0334859631 A -> G LOC_Os03g61430-LOC_Os03g61440 intergenic_region ; MODIFIER silent_mutation Average:16.807; most accessible tissue: Zhenshan97 panicle, score: 28.447 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0334859631 NA 6.05E-06 mr1053_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334859631 NA 2.08E-09 mr1649_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334859631 NA 9.65E-15 mr1720_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334859631 NA 3.07E-06 mr1754_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334859631 NA 2.51E-07 mr1804_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251