\
| Variant ID: vg0334859631 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 34859631 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TTTATTTTTGATTTTTTATTATTTCTAATTATATTTATATGTGGACTCTAAACTCATCTCTCAATATTCTTTAATTTTGAATTTCAGTTACTTCTAAATT[A/G]
TATTCCTATATTGACTTTAAACTCTTCTTCCCATGTTTTTCTTAATTTTGAATTTTAGTTATTTGTAAATTGTATTTTTATACAGACTCAAAACTCTACT
AGTAGAGTTTTGAGTCTGTATAAAAATACAATTTACAAATAACTAAAATTCAAAATTAAGAAAAACATGGGAAGAAGAGTTTAAAGTCAATATAGGAATA[T/C]
AATTTAGAAGTAACTGAAATTCAAAATTAAAGAATATTGAGAGATGAGTTTAGAGTCCACATATAAATATAATTAGAAATAATAAAAAATCAAAAATAAA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 49.00% | 48.30% | 2.12% | 0.66% | NA |
| All Indica | 2759 | 80.20% | 15.50% | 3.23% | 1.05% | NA |
| All Japonica | 1512 | 0.90% | 98.90% | 0.13% | 0.00% | NA |
| Aus | 269 | 19.00% | 78.40% | 2.23% | 0.37% | NA |
| Indica I | 595 | 89.20% | 4.50% | 5.88% | 0.34% | NA |
| Indica II | 465 | 75.70% | 15.50% | 5.16% | 3.66% | NA |
| Indica III | 913 | 81.10% | 17.40% | 1.20% | 0.33% | NA |
| Indica Intermediate | 786 | 74.90% | 21.80% | 2.42% | 0.89% | NA |
| Temperate Japonica | 767 | 0.70% | 99.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 1.60% | 98.20% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 0.40% | 99.20% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 5.20% | 94.80% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 35.60% | 60.00% | 3.33% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0334859631 | A -> DEL | N | N | silent_mutation | Average:16.807; most accessible tissue: Zhenshan97 panicle, score: 28.447 | N | N | N | N |
| vg0334859631 | A -> G | LOC_Os03g61430.1 | upstream_gene_variant ; 1747.0bp to feature; MODIFIER | silent_mutation | Average:16.807; most accessible tissue: Zhenshan97 panicle, score: 28.447 | N | N | N | N |
| vg0334859631 | A -> G | LOC_Os03g61450.1 | upstream_gene_variant ; 4642.0bp to feature; MODIFIER | silent_mutation | Average:16.807; most accessible tissue: Zhenshan97 panicle, score: 28.447 | N | N | N | N |
| vg0334859631 | A -> G | LOC_Os03g61440.1 | downstream_gene_variant ; 1129.0bp to feature; MODIFIER | silent_mutation | Average:16.807; most accessible tissue: Zhenshan97 panicle, score: 28.447 | N | N | N | N |
| vg0334859631 | A -> G | LOC_Os03g61430-LOC_Os03g61440 | intergenic_region ; MODIFIER | silent_mutation | Average:16.807; most accessible tissue: Zhenshan97 panicle, score: 28.447 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0334859631 | NA | 6.05E-06 | mr1053_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0334859631 | NA | 2.08E-09 | mr1649_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0334859631 | NA | 9.65E-15 | mr1720_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0334859631 | NA | 3.07E-06 | mr1754_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0334859631 | NA | 2.51E-07 | mr1804_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |