Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0334850928:

Variant ID: vg0334850928 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 34850928
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ACACGAGGGAACACGGCGTGTACCGCGATTTCATTATGTTATTATTATGAGATTGCATCTAGTAACAAGAAAATGTATGTGTTAGACAATAATTATGAAA[C/T]
TGACGGACTAACCATCCATACCGACAACATAGTGTGTGCCACCGCTCCTTTTCGATACGTACAATGCCCTACTATACGTTTTAATTTTATTCCTCATTAG

Reverse complement sequence

CTAATGAGGAATAAAATTAAAACGTATAGTAGGGCATTGTACGTATCGAAAAGGAGCGGTGGCACACACTATGTTGTCGGTATGGATGGTTAGTCCGTCA[G/A]
TTTCATAATTATTGTCTAACACATACATTTTCTTGTTACTAGATGCAATCTCATAATAATAACATAATGAAATCGCGGTACACGCCGTGTTCCCTCGTGT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 52.60% 47.10% 0.30% 0.00% NA
All Indica  2759 86.00% 13.40% 0.51% 0.00% NA
All Japonica  1512 0.90% 99.10% 0.00% 0.00% NA
Aus  269 22.30% 77.70% 0.00% 0.00% NA
Indica I  595 95.60% 3.20% 1.18% 0.00% NA
Indica II  465 85.60% 14.40% 0.00% 0.00% NA
Indica III  913 85.30% 14.30% 0.33% 0.00% NA
Indica Intermediate  786 79.90% 19.60% 0.51% 0.00% NA
Temperate Japonica  767 0.50% 99.50% 0.00% 0.00% NA
Tropical Japonica  504 1.40% 98.60% 0.00% 0.00% NA
Japonica Intermediate  241 0.80% 99.20% 0.00% 0.00% NA
VI/Aromatic  96 5.20% 94.80% 0.00% 0.00% NA
Intermediate  90 40.00% 60.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0334850928 C -> T LOC_Os03g61400.1 upstream_gene_variant ; 1328.0bp to feature; MODIFIER silent_mutation Average:60.23; most accessible tissue: Callus, score: 89.996 N N N N
vg0334850928 C -> T LOC_Os03g61419.1 upstream_gene_variant ; 2305.0bp to feature; MODIFIER silent_mutation Average:60.23; most accessible tissue: Callus, score: 89.996 N N N N
vg0334850928 C -> T LOC_Os03g61410.1 downstream_gene_variant ; 608.0bp to feature; MODIFIER silent_mutation Average:60.23; most accessible tissue: Callus, score: 89.996 N N N N
vg0334850928 C -> T LOC_Os03g61400-LOC_Os03g61410 intergenic_region ; MODIFIER silent_mutation Average:60.23; most accessible tissue: Callus, score: 89.996 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0334850928 C T 0.08 0.03 0.02 0.01 0.02 0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0334850928 NA 5.95E-06 mr1189 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334850928 NA 4.89E-15 mr1228 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334850928 1.29E-06 1.29E-06 mr1379 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334850928 NA 4.38E-06 mr1508 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334850928 NA 2.60E-12 mr1751 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334850928 NA 1.38E-06 mr1781 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334850928 NA 1.04E-06 mr1796 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334850928 NA 4.75E-14 mr1807 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334850928 NA 4.44E-06 mr1881 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334850928 NA 2.97E-22 mr1943 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334850928 NA 8.31E-07 mr1990 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334850928 NA 2.04E-19 mr1255_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251