\
| Variant ID: vg0334841623 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 34841623 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.71, A: 0.29, others allele: 0.00, population size: 45. )
GCTGGTCTCGCAGAAGGGGGGCCGAGAGCAGCCCCCAGTCTCGCGGGGGATCCAGCAGTACCCCGTCGTCCCGGGGGCGGACCGCGGCCTTTTCCTCCCC[A/G]
ACTCCGGCGAGTATGGAGCCACTTCTGCAGGTGCTCGCCGCCGCCGACTACACTGTACGAGAGGGGTTGAACACCCAAGTTCAAGCCCTAGCGGAAGAGC
GCTCTTCCGCTAGGGCTTGAACTTGGGTGTTCAACCCCTCTCGTACAGTGTAGTCGGCGGCGGCGAGCACCTGCAGAAGTGGCTCCATACTCGCCGGAGT[T/C]
GGGGAGGAAAAGGCCGCGGTCCGCCCCCGGGACGACGGGGTACTGCTGGATCCCCCGCGAGACTGGGGGCTGCTCTCGGCCCCCCTTCTGCGAGACCAGC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 53.00% | 25.70% | 21.18% | 0.06% | NA |
| All Indica | 2759 | 23.50% | 41.60% | 34.83% | 0.11% | NA |
| All Japonica | 1512 | 99.30% | 0.30% | 0.40% | 0.00% | NA |
| Aus | 269 | 77.70% | 18.20% | 4.09% | 0.00% | NA |
| Indica I | 595 | 12.40% | 36.10% | 51.09% | 0.34% | NA |
| Indica II | 465 | 22.80% | 40.40% | 36.77% | 0.00% | NA |
| Indica III | 913 | 24.80% | 49.20% | 25.96% | 0.11% | NA |
| Indica Intermediate | 786 | 30.80% | 37.50% | 31.68% | 0.00% | NA |
| Temperate Japonica | 767 | 99.50% | 0.30% | 0.26% | 0.00% | NA |
| Tropical Japonica | 504 | 99.00% | 0.20% | 0.79% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 94.80% | 2.10% | 3.12% | 0.00% | NA |
| Intermediate | 90 | 64.40% | 13.30% | 22.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0334841623 | A -> DEL | LOC_Os03g61390.1 | N | frameshift_variant | Average:68.665; most accessible tissue: Minghui63 young leaf, score: 86.015 | N | N | N | N |
| vg0334841623 | A -> G | LOC_Os03g61390.1 | synonymous_variant ; p.Pro215Pro; LOW | synonymous_codon | Average:68.665; most accessible tissue: Minghui63 young leaf, score: 86.015 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0334841623 | 6.90E-07 | 6.89E-07 | mr1313 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0334841623 | 7.79E-06 | 7.79E-06 | mr1313 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0334841623 | 1.98E-06 | 1.98E-06 | mr1473 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0334841623 | 6.28E-06 | 6.28E-06 | mr1473 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0334841623 | 1.41E-06 | 1.40E-06 | mr1664 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0334841623 | 1.68E-06 | 1.68E-06 | mr1664 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0334841623 | 8.09E-06 | 9.02E-06 | mr1060_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |