\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0334824768:

Variant ID: vg0334824768 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 34824768
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 227. )

Flanking Sequence (100 bp) in Reference Genome:


ACGCGCGACTTATCCGGATTTGTTTTGTTTTGGAAACATTTCGGACTTATCCGGATTTGTTTTGTTTTGGAAACATTCCGAAAAATCCGGTGCGTGAAAA[C/T]
GGCATGGAGTCCGGATAGGTTACGCGCGACTTATCCGGTTCGGTTTACGCGGGCGCCCTGATCAGGCGATCTATCTCTATATAAACCGAGCCGCCGCCTT

Reverse complement sequence

AAGGCGGCGGCTCGGTTTATATAGAGATAGATCGCCTGATCAGGGCGCCCGCGTAAACCGAACCGGATAAGTCGCGCGTAACCTATCCGGACTCCATGCC[G/A]
TTTTCACGCACCGGATTTTTCGGAATGTTTCCAAAACAAAACAAATCCGGATAAGTCCGAAATGTTTCCAAAACAAAACAAATCCGGATAAGTCGCGCGT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 85.60% 9.00% 4.59% 0.74% NA
All Indica  2759 76.40% 15.20% 7.43% 1.01% NA
All Japonica  1512 99.60% 0.30% 0.07% 0.07% NA
Aus  269 95.50% 0.00% 2.60% 1.86% NA
Indica I  595 74.80% 1.50% 21.51% 2.18% NA
Indica II  465 93.10% 5.40% 1.29% 0.22% NA
Indica III  913 65.50% 30.00% 3.29% 1.20% NA
Indica Intermediate  786 80.30% 14.10% 5.22% 0.38% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 99.20% 0.60% 0.00% 0.20% NA
Japonica Intermediate  241 99.60% 0.00% 0.41% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 90.00% 4.40% 4.44% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0334824768 C -> T LOC_Os03g61330.1 upstream_gene_variant ; 4397.0bp to feature; MODIFIER silent_mutation Average:12.11; most accessible tissue: Callus, score: 31.593 N N N N
vg0334824768 C -> T LOC_Os03g61340.1 upstream_gene_variant ; 1239.0bp to feature; MODIFIER silent_mutation Average:12.11; most accessible tissue: Callus, score: 31.593 N N N N
vg0334824768 C -> T LOC_Os03g61330.3 upstream_gene_variant ; 4397.0bp to feature; MODIFIER silent_mutation Average:12.11; most accessible tissue: Callus, score: 31.593 N N N N
vg0334824768 C -> T LOC_Os03g61330.2 upstream_gene_variant ; 4397.0bp to feature; MODIFIER silent_mutation Average:12.11; most accessible tissue: Callus, score: 31.593 N N N N
vg0334824768 C -> T LOC_Os03g61330.4 upstream_gene_variant ; 4397.0bp to feature; MODIFIER silent_mutation Average:12.11; most accessible tissue: Callus, score: 31.593 N N N N
vg0334824768 C -> T LOC_Os03g61360.1 downstream_gene_variant ; 713.0bp to feature; MODIFIER silent_mutation Average:12.11; most accessible tissue: Callus, score: 31.593 N N N N
vg0334824768 C -> T LOC_Os03g61340-LOC_Os03g61360 intergenic_region ; MODIFIER silent_mutation Average:12.11; most accessible tissue: Callus, score: 31.593 N N N N
vg0334824768 C -> DEL N N silent_mutation Average:12.11; most accessible tissue: Callus, score: 31.593 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0334824768 NA 7.39E-06 mr1119 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334824768 NA 5.60E-06 mr1305 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334824768 9.92E-06 1.85E-06 mr1516 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334824768 NA 7.82E-06 mr1917 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251