Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0334824768:

Variant ID: vg0334824768 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 34824768
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 227. )

Flanking Sequence (100 bp) in Reference Genome:

ACGCGCGACTTATCCGGATTTGTTTTGTTTTGGAAACATTTCGGACTTATCCGGATTTGTTTTGTTTTGGAAACATTCCGAAAAATCCGGTGCGTGAAAA[C/T]
GGCATGGAGTCCGGATAGGTTACGCGCGACTTATCCGGTTCGGTTTACGCGGGCGCCCTGATCAGGCGATCTATCTCTATATAAACCGAGCCGCCGCCTT

Reverse complement sequence

AAGGCGGCGGCTCGGTTTATATAGAGATAGATCGCCTGATCAGGGCGCCCGCGTAAACCGAACCGGATAAGTCGCGCGTAACCTATCCGGACTCCATGCC[G/A]
TTTTCACGCACCGGATTTTTCGGAATGTTTCCAAAACAAAACAAATCCGGATAAGTCCGAAATGTTTCCAAAACAAAACAAATCCGGATAAGTCGCGCGT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	85.60%	9.00%	4.59%	0.74%	NA
All Indica	2759	76.40%	15.20%	7.43%	1.01%	NA
All Japonica	1512	99.60%	0.30%	0.07%	0.07%	NA
Aus	269	95.50%	0.00%	2.60%	1.86%	NA
Indica I	595	74.80%	1.50%	21.51%	2.18%	NA
Indica II	465	93.10%	5.40%	1.29%	0.22%	NA
Indica III	913	65.50%	30.00%	3.29%	1.20%	NA
Indica Intermediate	786	80.30%	14.10%	5.22%	0.38%	NA
Temperate Japonica	767	99.90%	0.10%	0.00%	0.00%	NA
Tropical Japonica	504	99.20%	0.60%	0.00%	0.20%	NA
Japonica Intermediate	241	99.60%	0.00%	0.41%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	90.00%	4.40%	4.44%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0334824768	C -> T	LOC_Os03g61330.1	upstream_gene_variant ; 4397.0bp to feature; MODIFIER	silent_mutation	Average:12.11; most accessible tissue: Callus, score: 31.593	N	N	N	N
vg0334824768	C -> T	LOC_Os03g61340.1	upstream_gene_variant ; 1239.0bp to feature; MODIFIER	silent_mutation	Average:12.11; most accessible tissue: Callus, score: 31.593	N	N	N	N
vg0334824768	C -> T	LOC_Os03g61330.3	upstream_gene_variant ; 4397.0bp to feature; MODIFIER	silent_mutation	Average:12.11; most accessible tissue: Callus, score: 31.593	N	N	N	N
vg0334824768	C -> T	LOC_Os03g61330.2	upstream_gene_variant ; 4397.0bp to feature; MODIFIER	silent_mutation	Average:12.11; most accessible tissue: Callus, score: 31.593	N	N	N	N
vg0334824768	C -> T	LOC_Os03g61330.4	upstream_gene_variant ; 4397.0bp to feature; MODIFIER	silent_mutation	Average:12.11; most accessible tissue: Callus, score: 31.593	N	N	N	N
vg0334824768	C -> T	LOC_Os03g61360.1	downstream_gene_variant ; 713.0bp to feature; MODIFIER	silent_mutation	Average:12.11; most accessible tissue: Callus, score: 31.593	N	N	N	N
vg0334824768	C -> T	LOC_Os03g61340-LOC_Os03g61360	intergenic_region ; MODIFIER	silent_mutation	Average:12.11; most accessible tissue: Callus, score: 31.593	N	N	N	N
vg0334824768	C -> DEL	N	N	silent_mutation	Average:12.11; most accessible tissue: Callus, score: 31.593	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0334824768	NA	7.39E-06	mr1119	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334824768	NA	5.60E-06	mr1305	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334824768	9.92E-06	1.85E-06	mr1516	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334824768	NA	7.82E-06	mr1917	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251