\
| Variant ID: vg0334788563 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 34788563 |
| Reference Allele: T | Alternative Allele: G |
| Primary Allele: T | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
TTCCTTTTTTTTTCTAAATCTAAAAAAAAAGGTTATGTTGTTTCTCGAGAAAAATGTTATGTTATTACATTGCCTGTTTTTCCCAATACATGGAAAAAAT[T/G]
TAGTAAATTCAAGTACTAGTGTTGCAAAATCCAATATTTTGGGTGGATTTAGTAATTTGTGGAGGGCGAGGTGTATGGTTCTTTCATGAGGCATTCTCTC
GAGAGAATGCCTCATGAAAGAACCATACACCTCGCCCTCCACAAATTACTAAATCCACCCAAAATATTGGATTTTGCAACACTAGTACTTGAATTTACTA[A/C]
ATTTTTTCCATGTATTGGGAAAAACAGGCAATGTAATAACATAACATTTTTCTCGAGAAACAACATAACCTTTTTTTTTAGATTTAGAAAAAAAAAGGAA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 86.60% | 4.40% | 0.57% | 8.38% | NA |
| All Indica | 2759 | 78.00% | 7.10% | 0.91% | 14.06% | NA |
| All Japonica | 1512 | 99.70% | 0.00% | 0.00% | 0.26% | NA |
| Aus | 269 | 96.70% | 2.60% | 0.74% | 0.00% | NA |
| Indica I | 595 | 97.10% | 1.30% | 0.17% | 1.34% | NA |
| Indica II | 465 | 82.80% | 12.00% | 0.00% | 5.16% | NA |
| Indica III | 913 | 62.00% | 7.80% | 1.20% | 29.03% | NA |
| Indica Intermediate | 786 | 79.10% | 7.60% | 1.65% | 11.58% | NA |
| Temperate Japonica | 767 | 99.90% | 0.00% | 0.00% | 0.13% | NA |
| Tropical Japonica | 504 | 99.40% | 0.00% | 0.00% | 0.60% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 86.70% | 8.90% | 0.00% | 4.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0334788563 | T -> DEL | N | N | silent_mutation | Average:42.862; most accessible tissue: Zhenshan97 root, score: 79.452 | N | N | N | N |
| vg0334788563 | T -> G | LOC_Os03g61270.1 | upstream_gene_variant ; 3462.0bp to feature; MODIFIER | silent_mutation | Average:42.862; most accessible tissue: Zhenshan97 root, score: 79.452 | N | N | N | N |
| vg0334788563 | T -> G | LOC_Os03g61249.1 | downstream_gene_variant ; 3719.0bp to feature; MODIFIER | silent_mutation | Average:42.862; most accessible tissue: Zhenshan97 root, score: 79.452 | N | N | N | N |
| vg0334788563 | T -> G | LOC_Os03g61260.1 | downstream_gene_variant ; 1049.0bp to feature; MODIFIER | silent_mutation | Average:42.862; most accessible tissue: Zhenshan97 root, score: 79.452 | N | N | N | N |
| vg0334788563 | T -> G | LOC_Os03g61260.3 | downstream_gene_variant ; 1049.0bp to feature; MODIFIER | silent_mutation | Average:42.862; most accessible tissue: Zhenshan97 root, score: 79.452 | N | N | N | N |
| vg0334788563 | T -> G | LOC_Os03g61260.4 | downstream_gene_variant ; 1049.0bp to feature; MODIFIER | silent_mutation | Average:42.862; most accessible tissue: Zhenshan97 root, score: 79.452 | N | N | N | N |
| vg0334788563 | T -> G | LOC_Os03g61260-LOC_Os03g61270 | intergenic_region ; MODIFIER | silent_mutation | Average:42.862; most accessible tissue: Zhenshan97 root, score: 79.452 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0334788563 | 1.93E-06 | 5.82E-08 | mr1210 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0334788563 | NA | 2.98E-07 | mr1305 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0334788563 | NA | 4.38E-06 | mr1765 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0334788563 | NA | 2.05E-06 | mr1305_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |