\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0334788563:

Variant ID: vg0334788563 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 34788563
Reference Allele: TAlternative Allele: G
Primary Allele: TSecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTCCTTTTTTTTTCTAAATCTAAAAAAAAAGGTTATGTTGTTTCTCGAGAAAAATGTTATGTTATTACATTGCCTGTTTTTCCCAATACATGGAAAAAAT[T/G]
TAGTAAATTCAAGTACTAGTGTTGCAAAATCCAATATTTTGGGTGGATTTAGTAATTTGTGGAGGGCGAGGTGTATGGTTCTTTCATGAGGCATTCTCTC

Reverse complement sequence

GAGAGAATGCCTCATGAAAGAACCATACACCTCGCCCTCCACAAATTACTAAATCCACCCAAAATATTGGATTTTGCAACACTAGTACTTGAATTTACTA[A/C]
ATTTTTTCCATGTATTGGGAAAAACAGGCAATGTAATAACATAACATTTTTCTCGAGAAACAACATAACCTTTTTTTTTAGATTTAGAAAAAAAAAGGAA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 86.60% 4.40% 0.57% 8.38% NA
All Indica  2759 78.00% 7.10% 0.91% 14.06% NA
All Japonica  1512 99.70% 0.00% 0.00% 0.26% NA
Aus  269 96.70% 2.60% 0.74% 0.00% NA
Indica I  595 97.10% 1.30% 0.17% 1.34% NA
Indica II  465 82.80% 12.00% 0.00% 5.16% NA
Indica III  913 62.00% 7.80% 1.20% 29.03% NA
Indica Intermediate  786 79.10% 7.60% 1.65% 11.58% NA
Temperate Japonica  767 99.90% 0.00% 0.00% 0.13% NA
Tropical Japonica  504 99.40% 0.00% 0.00% 0.60% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 86.70% 8.90% 0.00% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0334788563 T -> DEL N N silent_mutation Average:42.862; most accessible tissue: Zhenshan97 root, score: 79.452 N N N N
vg0334788563 T -> G LOC_Os03g61270.1 upstream_gene_variant ; 3462.0bp to feature; MODIFIER silent_mutation Average:42.862; most accessible tissue: Zhenshan97 root, score: 79.452 N N N N
vg0334788563 T -> G LOC_Os03g61249.1 downstream_gene_variant ; 3719.0bp to feature; MODIFIER silent_mutation Average:42.862; most accessible tissue: Zhenshan97 root, score: 79.452 N N N N
vg0334788563 T -> G LOC_Os03g61260.1 downstream_gene_variant ; 1049.0bp to feature; MODIFIER silent_mutation Average:42.862; most accessible tissue: Zhenshan97 root, score: 79.452 N N N N
vg0334788563 T -> G LOC_Os03g61260.3 downstream_gene_variant ; 1049.0bp to feature; MODIFIER silent_mutation Average:42.862; most accessible tissue: Zhenshan97 root, score: 79.452 N N N N
vg0334788563 T -> G LOC_Os03g61260.4 downstream_gene_variant ; 1049.0bp to feature; MODIFIER silent_mutation Average:42.862; most accessible tissue: Zhenshan97 root, score: 79.452 N N N N
vg0334788563 T -> G LOC_Os03g61260-LOC_Os03g61270 intergenic_region ; MODIFIER silent_mutation Average:42.862; most accessible tissue: Zhenshan97 root, score: 79.452 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0334788563 1.93E-06 5.82E-08 mr1210 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334788563 NA 2.98E-07 mr1305 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334788563 NA 4.38E-06 mr1765 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334788563 NA 2.05E-06 mr1305_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251