Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0334732771:

Variant ID: vg0334732771 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 34732771
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GGTATGACTTTATGGAAAAAGAAAAGTAGGGAGATAGTTTGGACTGTAGATTAATCATTTAAAGGCTAAAAACAATTGTGTGATATGACTTAATTAGAGG[A/G]
AAAAAAGAGAAAGATAATTTGGACCATAGATTAATCATTTAAGCACTAATTAACTAAGTGAGAATTAACTATATAAGTATATAGAATATCATAAAACACA

Reverse complement sequence

TGTGTTTTATGATATTCTATATACTTATATAGTTAATTCTCACTTAGTTAATTAGTGCTTAAATGATTAATCTATGGTCCAAATTATCTTTCTCTTTTTT[T/C]
CCTCTAATTAAGTCATATCACACAATTGTTTTTAGCCTTTAAATGATTAATCTACAGTCCAAACTATCTCCCTACTTTTCTTTTTCCATAAAGTCATACC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	51.00%	48.90%	0.06%	0.00%	NA
All Indica	2759	76.00%	24.00%	0.04%	0.00%	NA
All Japonica	1512	2.10%	97.80%	0.07%	0.00%	NA
Aus	269	81.00%	18.60%	0.37%	0.00%	NA
Indica I	595	96.60%	3.40%	0.00%	0.00%	NA
Indica II	465	89.50%	10.50%	0.00%	0.00%	NA
Indica III	913	55.30%	44.70%	0.00%	0.00%	NA
Indica Intermediate	786	76.30%	23.50%	0.13%	0.00%	NA
Temperate Japonica	767	0.70%	99.30%	0.00%	0.00%	NA
Tropical Japonica	504	4.40%	95.40%	0.20%	0.00%	NA
Japonica Intermediate	241	2.10%	97.90%	0.00%	0.00%	NA
VI/Aromatic	96	19.80%	80.20%	0.00%	0.00%	NA
Intermediate	90	50.00%	50.00%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0334732771	A -> G	LOC_Os03g61140.1	upstream_gene_variant ; 1238.0bp to feature; MODIFIER	silent_mutation	Average:46.502; most accessible tissue: Minghui63 panicle, score: 89.175	N	N	N	N
vg0334732771	A -> G	LOC_Os03g61140.2	upstream_gene_variant ; 1240.0bp to feature; MODIFIER	silent_mutation	Average:46.502; most accessible tissue: Minghui63 panicle, score: 89.175	N	N	N	N
vg0334732771	A -> G	LOC_Os03g61150.1	downstream_gene_variant ; 682.0bp to feature; MODIFIER	silent_mutation	Average:46.502; most accessible tissue: Minghui63 panicle, score: 89.175	N	N	N	N
vg0334732771	A -> G	LOC_Os03g61150.2	downstream_gene_variant ; 682.0bp to feature; MODIFIER	silent_mutation	Average:46.502; most accessible tissue: Minghui63 panicle, score: 89.175	N	N	N	N
vg0334732771	A -> G	LOC_Os03g61150.3	downstream_gene_variant ; 700.0bp to feature; MODIFIER	silent_mutation	Average:46.502; most accessible tissue: Minghui63 panicle, score: 89.175	N	N	N	N
vg0334732771	A -> G	LOC_Os03g61140-LOC_Os03g61150	intergenic_region ; MODIFIER	silent_mutation	Average:46.502; most accessible tissue: Minghui63 panicle, score: 89.175	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0334732771	NA	9.21E-11	Heading_date	Ind_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0334732771	NA	5.18E-08	mr1305	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334732771	NA	3.77E-06	mr1881	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334732771	NA	3.25E-06	mr1133_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334732771	1.86E-07	4.57E-09	mr1305_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334732771	NA	5.33E-06	mr1409_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334732771	4.12E-06	4.13E-06	mr1765_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251