\
| Variant ID: vg0334694264 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 34694264 |
| Reference Allele: C | Alternative Allele: A |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, A: 0.01, others allele: 0.00, population size: 286. )
AATGGCAGCAAAACTGTAAAACTAAACAACGCAGCATTCTAGAATACTAATTACAATCAGCTCGTTACTTTATACACGTGACACTATCATAAGTGTTGAC[C/A]
CTGAAAATTGTGAAAAAGTACAGATATAACAATGCAGTAAAAACAGAAGATGCAAGCAACAATTTAACATACTGATCAGTGGAATTCCAGTTGATAACCT
AGGTTATCAACTGGAATTCCACTGATCAGTATGTTAAATTGTTGCTTGCATCTTCTGTTTTTACTGCATTGTTATATCTGTACTTTTTCACAATTTTCAG[G/T]
GTCAACACTTATGATAGTGTCACGTGTATAAAGTAACGAGCTGATTGTAATTAGTATTCTAGAATGCTGCGTTGTTTAGTTTTACAGTTTTGCTGCCATT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 89.80% | 10.20% | 0.00% | 0.00% | NA |
| All Indica | 2759 | 89.90% | 10.10% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 98.40% | 1.60% | 0.00% | 0.00% | NA |
| Aus | 269 | 41.30% | 58.70% | 0.00% | 0.00% | NA |
| Indica I | 595 | 98.50% | 1.50% | 0.00% | 0.00% | NA |
| Indica II | 465 | 90.10% | 9.90% | 0.00% | 0.00% | NA |
| Indica III | 913 | 86.50% | 13.50% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 87.20% | 12.80% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 96.00% | 4.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 85.40% | 14.60% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 91.10% | 8.90% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0334694264 | C -> A | LOC_Os03g61060.1 | upstream_gene_variant ; 3527.0bp to feature; MODIFIER | silent_mutation | Average:41.687; most accessible tissue: Callus, score: 76.138 | N | N | N | N |
| vg0334694264 | C -> A | LOC_Os03g61060.2 | upstream_gene_variant ; 3587.0bp to feature; MODIFIER | silent_mutation | Average:41.687; most accessible tissue: Callus, score: 76.138 | N | N | N | N |
| vg0334694264 | C -> A | LOC_Os03g61070.1 | intron_variant ; MODIFIER | silent_mutation | Average:41.687; most accessible tissue: Callus, score: 76.138 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0334694264 | NA | 8.21E-06 | mr1230 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0334694264 | NA | 2.43E-06 | mr1392 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0334694264 | 5.76E-07 | NA | mr1655 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0334694264 | 4.00E-06 | 4.00E-06 | mr1655 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0334694264 | NA | 1.18E-08 | mr1166_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0334694264 | 4.49E-06 | 6.95E-10 | mr1649_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0334694264 | 3.55E-07 | NA | mr1671_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0334694264 | 9.68E-06 | NA | mr1770_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |