\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0334694264:

Variant ID: vg0334694264 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 34694264
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, A: 0.01, others allele: 0.00, population size: 286. )

Flanking Sequence (100 bp) in Reference Genome:


AATGGCAGCAAAACTGTAAAACTAAACAACGCAGCATTCTAGAATACTAATTACAATCAGCTCGTTACTTTATACACGTGACACTATCATAAGTGTTGAC[C/A]
CTGAAAATTGTGAAAAAGTACAGATATAACAATGCAGTAAAAACAGAAGATGCAAGCAACAATTTAACATACTGATCAGTGGAATTCCAGTTGATAACCT

Reverse complement sequence

AGGTTATCAACTGGAATTCCACTGATCAGTATGTTAAATTGTTGCTTGCATCTTCTGTTTTTACTGCATTGTTATATCTGTACTTTTTCACAATTTTCAG[G/T]
GTCAACACTTATGATAGTGTCACGTGTATAAAGTAACGAGCTGATTGTAATTAGTATTCTAGAATGCTGCGTTGTTTAGTTTTACAGTTTTGCTGCCATT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 89.80% 10.20% 0.00% 0.00% NA
All Indica  2759 89.90% 10.10% 0.00% 0.00% NA
All Japonica  1512 98.40% 1.60% 0.00% 0.00% NA
Aus  269 41.30% 58.70% 0.00% 0.00% NA
Indica I  595 98.50% 1.50% 0.00% 0.00% NA
Indica II  465 90.10% 9.90% 0.00% 0.00% NA
Indica III  913 86.50% 13.50% 0.00% 0.00% NA
Indica Intermediate  786 87.20% 12.80% 0.00% 0.00% NA
Temperate Japonica  767 99.70% 0.30% 0.00% 0.00% NA
Tropical Japonica  504 96.00% 4.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.20% 0.80% 0.00% 0.00% NA
VI/Aromatic  96 85.40% 14.60% 0.00% 0.00% NA
Intermediate  90 91.10% 8.90% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0334694264 C -> A LOC_Os03g61060.1 upstream_gene_variant ; 3527.0bp to feature; MODIFIER silent_mutation Average:41.687; most accessible tissue: Callus, score: 76.138 N N N N
vg0334694264 C -> A LOC_Os03g61060.2 upstream_gene_variant ; 3587.0bp to feature; MODIFIER silent_mutation Average:41.687; most accessible tissue: Callus, score: 76.138 N N N N
vg0334694264 C -> A LOC_Os03g61070.1 intron_variant ; MODIFIER silent_mutation Average:41.687; most accessible tissue: Callus, score: 76.138 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0334694264 NA 8.21E-06 mr1230 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334694264 NA 2.43E-06 mr1392 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334694264 5.76E-07 NA mr1655 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334694264 4.00E-06 4.00E-06 mr1655 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334694264 NA 1.18E-08 mr1166_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334694264 4.49E-06 6.95E-10 mr1649_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334694264 3.55E-07 NA mr1671_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334694264 9.68E-06 NA mr1770_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251