\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0334678225:

Variant ID: vg0334678225 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 34678225
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.68, T: 0.31, others allele: 0.00, population size: 209. )

Flanking Sequence (100 bp) in Reference Genome:


TCTGCACGGGCCACATGCTCACATCTGGGCTGGAGTAACACAGGATGAGAAGAGAAGAGCGCCGGCGCATGGTGTACTTGTTGCTCTCGCGGTCTCGCCT[C/T]
TTGCGATTGGAGCGTCACAAACAGCACATCTCTGGATCGTCATCCATGCCAATCAGATGGCAGCACCAACGAGTAGTAGATCCAATAGAATAATAAGAAG

Reverse complement sequence

CTTCTTATTATTCTATTGGATCTACTACTCGTTGGTGCTGCCATCTGATTGGCATGGATGACGATCCAGAGATGTGCTGTTTGTGACGCTCCAATCGCAA[G/A]
AGGCGAGACCGCGAGAGCAACAAGTACACCATGCGCCGGCGCTCTTCTCTTCTCATCCTGTGTTACTCCAGCCCAGATGTGAGCATGTGGCCCGTGCAGA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 56.00% 43.90% 0.08% 0.00% NA
All Indica  2759 84.60% 15.40% 0.07% 0.00% NA
All Japonica  1512 2.20% 97.80% 0.00% 0.00% NA
Aus  269 81.00% 18.60% 0.37% 0.00% NA
Indica I  595 98.20% 1.80% 0.00% 0.00% NA
Indica II  465 84.90% 14.80% 0.22% 0.00% NA
Indica III  913 78.10% 21.80% 0.11% 0.00% NA
Indica Intermediate  786 81.60% 18.40% 0.00% 0.00% NA
Temperate Japonica  767 0.80% 99.20% 0.00% 0.00% NA
Tropical Japonica  504 4.60% 95.40% 0.00% 0.00% NA
Japonica Intermediate  241 1.70% 98.30% 0.00% 0.00% NA
VI/Aromatic  96 19.80% 80.20% 0.00% 0.00% NA
Intermediate  90 46.70% 52.20% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0334678225 C -> T LOC_Os03g61040.1 upstream_gene_variant ; 1302.0bp to feature; MODIFIER silent_mutation Average:96.989; most accessible tissue: Callus, score: 99.8 N N N N
vg0334678225 C -> T LOC_Os03g61050.1 upstream_gene_variant ; 1752.0bp to feature; MODIFIER silent_mutation Average:96.989; most accessible tissue: Callus, score: 99.8 N N N N
vg0334678225 C -> T LOC_Os03g61030.1 downstream_gene_variant ; 3731.0bp to feature; MODIFIER silent_mutation Average:96.989; most accessible tissue: Callus, score: 99.8 N N N N
vg0334678225 C -> T LOC_Os03g61040-LOC_Os03g61050 intergenic_region ; MODIFIER silent_mutation Average:96.989; most accessible tissue: Callus, score: 99.8 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0334678225 C T 0.02 0.02 0.03 0.05 0.08 0.08

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0334678225 NA 7.39E-27 mr1072 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334678225 NA 2.70E-28 mr1075 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334678225 NA 7.60E-06 mr1617 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334678225 NA 2.50E-08 mr1770 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334678225 NA 3.98E-16 mr1842 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334678225 NA 1.54E-06 mr1036_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334678225 NA 2.49E-06 mr1169_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334678225 NA 3.32E-07 mr1212_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334678225 NA 9.59E-06 mr1305_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334678225 NA 8.10E-11 mr1537_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334678225 NA 1.95E-17 mr1592_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334678225 NA 6.84E-06 mr1594_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334678225 NA 1.01E-10 mr1595_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334678225 NA 1.44E-09 mr1600_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334678225 1.95E-06 1.34E-08 mr1705_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334678225 NA 4.74E-09 mr1783_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334678225 NA 2.02E-14 mr1790_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334678225 NA 1.05E-07 mr1804_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334678225 NA 8.75E-17 mr1842_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334678225 NA 5.64E-08 mr1842_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334678225 NA 1.97E-34 mr1888_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251