\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0334662669:

Variant ID: vg0334662669 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 34662669
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, others allele: 0.00, population size: 250. )

Flanking Sequence (100 bp) in Reference Genome:


TTTTTTCAAATAGATAAGTTGCAGTTACCTCTGCTATGTAAAGCAAACAATTTATACATTGGGCCAAGAATCATCCTCATTTATCCTAAACAAATACTAG[T/C]
TGTTTTTAATCAGAATTATCGTCTGTCAAGATAATATATTATAAGCTAGTATTACTTTTGTATCTAAATTTGGGCTAGGGATTATCCTCAGCAATTTGAT

Reverse complement sequence

ATCAAATTGCTGAGGATAATCCCTAGCCCAAATTTAGATACAAAAGTAATACTAGCTTATAATATATTATCTTGACAGACGATAATTCTGATTAAAAACA[A/G]
CTAGTATTTGTTTAGGATAAATGAGGATGATTCTTGGCCCAATGTATAAATTGTTTGCTTTACATAGCAGAGGTAACTGCAACTTATCTATTTGAAAAAA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 91.40% 8.60% 0.02% 0.00% NA
All Indica  2759 85.50% 14.40% 0.04% 0.00% NA
All Japonica  1512 99.90% 0.10% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 98.50% 1.50% 0.00% 0.00% NA
Indica II  465 85.40% 14.40% 0.22% 0.00% NA
Indica III  913 75.10% 24.90% 0.00% 0.00% NA
Indica Intermediate  786 87.90% 12.10% 0.00% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.60% 0.40% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 92.20% 7.80% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0334662669 T -> C LOC_Os03g61010.1 upstream_gene_variant ; 674.0bp to feature; MODIFIER silent_mutation Average:55.824; most accessible tissue: Callus, score: 76.281 N N N N
vg0334662669 T -> C LOC_Os03g60992-LOC_Os03g61010 intergenic_region ; MODIFIER silent_mutation Average:55.824; most accessible tissue: Callus, score: 76.281 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0334662669 NA 5.40E-06 mr1114 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334662669 1.79E-06 1.79E-06 mr1655 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334662669 NA 1.34E-06 mr1113_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334662669 NA 4.01E-06 mr1114_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334662669 5.21E-06 1.15E-08 mr1117_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334662669 2.97E-06 1.95E-08 mr1119_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334662669 NA 4.63E-08 mr1120_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334662669 NA 5.67E-06 mr1123_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334662669 2.57E-06 1.06E-06 mr1240_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334662669 4.80E-06 1.84E-08 mr1247_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334662669 5.29E-07 NA mr1671_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251