Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0334662669:

Variant ID: vg0334662669 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 34662669
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, others allele: 0.00, population size: 250. )

Flanking Sequence (100 bp) in Reference Genome:

TTTTTTCAAATAGATAAGTTGCAGTTACCTCTGCTATGTAAAGCAAACAATTTATACATTGGGCCAAGAATCATCCTCATTTATCCTAAACAAATACTAG[T/C]
TGTTTTTAATCAGAATTATCGTCTGTCAAGATAATATATTATAAGCTAGTATTACTTTTGTATCTAAATTTGGGCTAGGGATTATCCTCAGCAATTTGAT

Reverse complement sequence

ATCAAATTGCTGAGGATAATCCCTAGCCCAAATTTAGATACAAAAGTAATACTAGCTTATAATATATTATCTTGACAGACGATAATTCTGATTAAAAACA[A/G]
CTAGTATTTGTTTAGGATAAATGAGGATGATTCTTGGCCCAATGTATAAATTGTTTGCTTTACATAGCAGAGGTAACTGCAACTTATCTATTTGAAAAAA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	91.40%	8.60%	0.02%	0.00%	NA
All Indica	2759	85.50%	14.40%	0.04%	0.00%	NA
All Japonica	1512	99.90%	0.10%	0.00%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	98.50%	1.50%	0.00%	0.00%	NA
Indica II	465	85.40%	14.40%	0.22%	0.00%	NA
Indica III	913	75.10%	24.90%	0.00%	0.00%	NA
Indica Intermediate	786	87.90%	12.10%	0.00%	0.00%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	99.60%	0.40%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	92.20%	7.80%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0334662669	T -> C	LOC_Os03g61010.1	upstream_gene_variant ; 674.0bp to feature; MODIFIER	silent_mutation	Average:55.824; most accessible tissue: Callus, score: 76.281	N	N	N	N
vg0334662669	T -> C	LOC_Os03g60992-LOC_Os03g61010	intergenic_region ; MODIFIER	silent_mutation	Average:55.824; most accessible tissue: Callus, score: 76.281	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0334662669	NA	5.40E-06	mr1114	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334662669	1.79E-06	1.79E-06	mr1655	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334662669	NA	1.34E-06	mr1113_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334662669	NA	4.01E-06	mr1114_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334662669	5.21E-06	1.15E-08	mr1117_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334662669	2.97E-06	1.95E-08	mr1119_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334662669	NA	4.63E-08	mr1120_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334662669	NA	5.67E-06	mr1123_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334662669	2.57E-06	1.06E-06	mr1240_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334662669	4.80E-06	1.84E-08	mr1247_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334662669	5.29E-07	NA	mr1671_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251