\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0334659359:

Variant ID: vg0334659359 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 34659359
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTTAATTCTAAATTTCTATTATTTCCTAATTGTATTTCTATATGGACTCTATACTATACTTCTAATATTCCTTATTTTTAATTCTGAATTTCAGTTATTT[T/C]
CTAATTGTATTTCTATATGGACTCTAGTATCCTCTTCTAATATTCCTTATTTTTTAATTCCGAATTTCGGCTATTTCTAAATTGTATTTCTATATGGACT

Reverse complement sequence

AGTCCATATAGAAATACAATTTAGAAATAGCCGAAATTCGGAATTAAAAAATAAGGAATATTAGAAGAGGATACTAGAGTCCATATAGAAATACAATTAG[A/G]
AAATAACTGAAATTCAGAATTAAAAATAAGGAATATTAGAAGTATAGTATAGAGTCCATATAGAAATACAATTAGGAAATAATAGAAATTTAGAATTAAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 63.70% 36.00% 0.25% 0.00% NA
All Indica  2759 97.50% 2.40% 0.11% 0.00% NA
All Japonica  1512 2.40% 97.60% 0.00% 0.00% NA
Aus  269 79.60% 17.50% 2.97% 0.00% NA
Indica I  595 99.30% 0.30% 0.34% 0.00% NA
Indica II  465 97.60% 2.20% 0.22% 0.00% NA
Indica III  913 96.30% 3.70% 0.00% 0.00% NA
Indica Intermediate  786 97.30% 2.70% 0.00% 0.00% NA
Temperate Japonica  767 0.80% 99.20% 0.00% 0.00% NA
Tropical Japonica  504 5.20% 94.80% 0.00% 0.00% NA
Japonica Intermediate  241 2.10% 97.90% 0.00% 0.00% NA
VI/Aromatic  96 18.80% 80.20% 1.04% 0.00% NA
Intermediate  90 58.90% 41.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0334659359 T -> C LOC_Os03g61010.1 upstream_gene_variant ; 3984.0bp to feature; MODIFIER silent_mutation Average:19.659; most accessible tissue: Minghui63 panicle, score: 53.77 N N N N
vg0334659359 T -> C LOC_Os03g60992-LOC_Os03g61010 intergenic_region ; MODIFIER silent_mutation Average:19.659; most accessible tissue: Minghui63 panicle, score: 53.77 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0334659359 NA 2.44E-26 mr1072 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334659359 NA 3.46E-40 mr1124 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334659359 NA 6.84E-14 mr1376 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334659359 NA 6.84E-14 mr1431 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334659359 NA 2.42E-17 mr1566 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334659359 NA 1.72E-08 mr1595 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334659359 NA 3.99E-76 mr1629 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334659359 NA 2.08E-39 mr1891 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334659359 NA 2.11E-08 mr1084_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334659359 NA 2.41E-08 mr1205_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334659359 NA 1.30E-06 mr1227_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334659359 NA 6.70E-19 mr1239_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334659359 1.58E-06 NA mr1320_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334659359 NA 2.80E-07 mr1376_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334659359 NA 6.08E-24 mr1386_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334659359 NA 1.43E-07 mr1431_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334659359 NA 5.05E-14 mr1575_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334659359 NA 4.95E-36 mr1723_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334659359 NA 5.03E-41 mr1944_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251