\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0334657752:

Variant ID: vg0334657752 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 34657752
Reference Allele: CAlternative Allele: A,T
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.75, A: 0.25, others allele: 0.00, population size: 245. )

Flanking Sequence (100 bp) in Reference Genome:


TGAAGCCGGATACGCGTCGGTCCCGTCTCCCGTGGCCGTGGCACAGCAGCAGTGACAAGCAAAAGATTTCTCCTCAGGCACATGCACGGAGAAGAAAGAG[C/A,T]
TCTCTCTCACACAACACAATCTGCACGTCGGCCTTCCCATCTGTGTGATCTGTCTGCTGGTGCTGCTTGTGGTGCAGAGCGTGCCGACGTCCAGTGTGCG

Reverse complement sequence

CGCACACTGGACGTCGGCACGCTCTGCACCACAAGCAGCACCAGCAGACAGATCACACAGATGGGAAGGCCGACGTGCAGATTGTGTTGTGTGAGAGAGA[G/T,A]
CTCTTTCTTCTCCGTGCATGTGCCTGAGGAGAAATCTTTTGCTTGTCACTGCTGCTGTGCCACGGCCACGGGAGACGGGACCGACGCGTATCCGGCTTCA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 51.40% 48.50% 0.08% 0.00% T: 0.02%
All Indica  2759 83.10% 16.70% 0.11% 0.00% NA
All Japonica  1512 0.70% 99.20% 0.00% 0.00% T: 0.07%
Aus  269 31.20% 68.80% 0.00% 0.00% NA
Indica I  595 98.00% 1.80% 0.17% 0.00% NA
Indica II  465 83.00% 16.80% 0.22% 0.00% NA
Indica III  913 73.80% 26.20% 0.00% 0.00% NA
Indica Intermediate  786 82.80% 17.00% 0.13% 0.00% NA
Temperate Japonica  767 0.50% 99.50% 0.00% 0.00% NA
Tropical Japonica  504 1.00% 98.80% 0.00% 0.00% T: 0.20%
Japonica Intermediate  241 0.80% 99.20% 0.00% 0.00% NA
VI/Aromatic  96 5.20% 94.80% 0.00% 0.00% NA
Intermediate  90 40.00% 58.90% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0334657752 C -> T LOC_Os03g60992.1 upstream_gene_variant ; 4252.0bp to feature; MODIFIER silent_mutation Average:84.934; most accessible tissue: Zhenshan97 panicle, score: 99.325 N N N N
vg0334657752 C -> T LOC_Os03g60992-LOC_Os03g61010 intergenic_region ; MODIFIER silent_mutation Average:84.934; most accessible tissue: Zhenshan97 panicle, score: 99.325 N N N N
vg0334657752 C -> A LOC_Os03g60992.1 upstream_gene_variant ; 4252.0bp to feature; MODIFIER silent_mutation Average:84.934; most accessible tissue: Zhenshan97 panicle, score: 99.325 N N N N
vg0334657752 C -> A LOC_Os03g60992-LOC_Os03g61010 intergenic_region ; MODIFIER silent_mutation Average:84.934; most accessible tissue: Zhenshan97 panicle, score: 99.325 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0334657752 C A 0.03 0.06 0.05 -0.11 0.03 0.03
vg0334657752 C T 0.0 -0.01 0.0 -0.05 0.0 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0334657752 NA 9.70E-12 mr1609 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334657752 9.26E-06 1.06E-16 mr1655 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334657752 2.61E-06 1.24E-61 mr1671 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334657752 1.04E-07 1.87E-06 mr1671 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334657752 NA 1.20E-10 mr1751 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334657752 NA 1.20E-09 mr1770 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334657752 NA 1.83E-25 mr1051_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334657752 NA 6.26E-07 mr1113_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334657752 6.45E-06 1.58E-06 mr1114_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334657752 2.89E-06 3.63E-08 mr1117_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334657752 2.75E-06 2.39E-08 mr1119_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334657752 NA 1.97E-06 mr1120_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334657752 NA 5.14E-18 mr1131_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334657752 NA 3.17E-37 mr1208_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334657752 3.94E-06 3.21E-06 mr1240_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334657752 NA 1.13E-06 mr1247_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334657752 NA 1.42E-19 mr1362_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334657752 NA 1.78E-22 mr1551_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334657752 NA 8.16E-23 mr1609_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334657752 5.23E-06 2.91E-78 mr1671_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334657752 1.46E-07 8.27E-07 mr1671_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334657752 NA 3.38E-51 mr1721_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334657752 NA 6.33E-13 mr1770_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334657752 NA 1.06E-07 mr1783_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334657752 NA 1.29E-07 mr1804_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334657752 NA 2.08E-15 mr1938_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251