Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0334655144:

Variant ID: vg0334655144 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 34655144
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.78, C: 0.22, others allele: 0.00, population size: 241. )

Flanking Sequence (100 bp) in Reference Genome:


TCATCTCGCTCGCTCCCTTTCGCTTTCGTTGTTTTGGGGAGCAATTGATTAGCACATCTGCATAACATAAACAAAGGCGGCGTAATCTGATAAGCATCTG[T/C]
ATGCTGGCCTCTCCGATGGGCTGCAGGCCTTGACGCTTTCTAGCTGCCCTCAACTTAATCCAGGTTGGCTTCAGTTCGTTCGCGGCTTCGCGTCGCTTGC

Reverse complement sequence

GCAAGCGACGCGAAGCCGCGAACGAACTGAAGCCAACCTGGATTAAGTTGAGGGCAGCTAGAAAGCGTCAAGGCCTGCAGCCCATCGGAGAGGCCAGCAT[A/G]
CAGATGCTTATCAGATTACGCCGCCTTTGTTTATGTTATGCAGATGTGCTAATCAATTGCTCCCCAAAACAACGAAAGCGAAAGGGAGCGAGCGAGATGA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 90.00% 9.90% 0.08% 0.00% NA
All Indica  2759 83.50% 16.50% 0.07% 0.00% NA
All Japonica  1512 99.80% 0.20% 0.00% 0.00% NA
Aus  269 98.90% 0.70% 0.37% 0.00% NA
Indica I  595 98.30% 1.70% 0.00% 0.00% NA
Indica II  465 85.20% 14.80% 0.00% 0.00% NA
Indica III  913 71.90% 28.00% 0.11% 0.00% NA
Indica Intermediate  786 84.70% 15.10% 0.13% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.60% 0.40% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 95.80% 4.20% 0.00% 0.00% NA
Intermediate  90 91.10% 7.80% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0334655144 T -> C LOC_Os03g60992.1 upstream_gene_variant ; 1644.0bp to feature; MODIFIER silent_mutation Average:91.407; most accessible tissue: Minghui63 root, score: 98.393 N N N N
vg0334655144 T -> C LOC_Os03g60992-LOC_Os03g61010 intergenic_region ; MODIFIER silent_mutation Average:91.407; most accessible tissue: Minghui63 root, score: 98.393 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0334655144 T C -0.09 -0.04 -0.04 0.0 -0.03 -0.05

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0334655144 NA 3.19E-06 mr1113_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334655144 NA 5.28E-06 mr1114_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334655144 NA 1.73E-06 mr1117_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334655144 1.84E-06 3.05E-07 mr1119_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334655144 NA 1.57E-06 mr1120_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334655144 7.94E-06 NA mr1240_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334655144 NA 6.06E-06 mr1247_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334655144 1.70E-06 3.90E-07 mr1594_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334655144 1.84E-06 NA mr1661_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334655144 NA 2.40E-06 mr1705_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334655144 NA 4.85E-07 mr1842_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251