Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0334632285:

Variant ID: vg0334632285 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 34632285
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TATCTTTGAAGATGTATTCAATCCAGAATTTTCTTTGCAAAAATAGTCTGCTATAGCTCATTTTCCTCATCAATATGCTTTTGTCAACTCTAAATGGAAT[T/C]
GGTATAGCCGTATAGGTATTAAATACTTTAGTGTTGCTGAAAGATTGTTTGTGTCAGATGTTAGAAATATCTGAAACTTTAGAGCAAAGTCCATTACAGT

Reverse complement sequence

ACTGTAATGGACTTTGCTCTAAAGTTTCAGATATTTCTAACATCTGACACAAACAATCTTTCAGCAACACTAAAGTATTTAATACCTATACGGCTATACC[A/G]
ATTCCATTTAGAGTTGACAAAAGCATATTGATGAGGAAAATGAGCTATAGCAGACTATTTTTGCAAAGAAAATTCTGGATTGAATACATCTTCAAAGATA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	64.30%	35.50%	0.13%	0.13%	NA
All Indica	2759	97.60%	2.00%	0.22%	0.18%	NA
All Japonica	1512	2.40%	97.60%	0.00%	0.00%	NA
Aus	269	88.80%	11.20%	0.00%	0.00%	NA
Indica I	595	99.50%	0.00%	0.34%	0.17%	NA
Indica II	465	97.80%	1.90%	0.22%	0.00%	NA
Indica III	913	97.00%	2.80%	0.11%	0.00%	NA
Indica Intermediate	786	96.60%	2.70%	0.25%	0.51%	NA
Temperate Japonica	767	0.80%	99.20%	0.00%	0.00%	NA
Tropical Japonica	504	5.00%	95.00%	0.00%	0.00%	NA
Japonica Intermediate	241	2.10%	97.90%	0.00%	0.00%	NA
VI/Aromatic	96	19.80%	80.20%	0.00%	0.00%	NA
Intermediate	90	57.80%	41.10%	0.00%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0334632285	T -> C	LOC_Os03g60960.1	upstream_gene_variant ; 4657.0bp to feature; MODIFIER	silent_mutation	Average:50.42; most accessible tissue: Callus, score: 80.774	N	N	N	N
vg0334632285	T -> C	LOC_Os03g60950.1	downstream_gene_variant ; 1306.0bp to feature; MODIFIER	silent_mutation	Average:50.42; most accessible tissue: Callus, score: 80.774	N	N	N	N
vg0334632285	T -> C	LOC_Os03g60950.2	downstream_gene_variant ; 1324.0bp to feature; MODIFIER	silent_mutation	Average:50.42; most accessible tissue: Callus, score: 80.774	N	N	N	N
vg0334632285	T -> C	LOC_Os03g60939.1	intron_variant ; MODIFIER	silent_mutation	Average:50.42; most accessible tissue: Callus, score: 80.774	N	N	N	N
vg0334632285	T -> DEL	N	N	silent_mutation	Average:50.42; most accessible tissue: Callus, score: 80.774	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0334632285	NA	2.97E-21	mr1003	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334632285	NA	1.65E-29	mr1075	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334632285	NA	4.01E-40	mr1124	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334632285	NA	4.76E-27	mr1309	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334632285	NA	6.19E-32	mr1448	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334632285	NA	1.62E-86	mr1517	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334632285	NA	2.20E-18	mr1566	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334632285	NA	8.62E-44	mr1591	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334632285	NA	1.55E-58	mr1594	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334632285	NA	8.64E-82	mr1629	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334632285	NA	3.50E-10	mr1630	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334632285	NA	3.59E-33	mr1733	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334632285	NA	2.28E-52	mr1795	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334632285	NA	6.88E-23	mr1841	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334632285	NA	2.55E-55	mr1861	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334632285	NA	9.99E-43	mr1890	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334632285	NA	4.76E-43	mr1891	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334632285	NA	7.90E-15	mr1933	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334632285	NA	7.32E-10	mr1945	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334632285	NA	2.84E-80	mr1027_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334632285	NA	6.24E-79	mr1671_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334632285	NA	1.14E-34	mr1723_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334632285	NA	5.82E-86	mr1795_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334632285	NA	8.37E-32	mr1841_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334632285	NA	8.36E-41	mr1944_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251