\
| Variant ID: vg0334626484 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 34626484 |
| Reference Allele: G | Alternative Allele: T |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.01, others allele: 0.00, population size: 209. )
TTTGGGAAGCACAGTGGAATATCCAAGTATTAAATCCAATAAAGCAAACATCTGTTTGCTGCCATCTTCTTTTTTAATGCTTCAAGCTGCTACACCTAGA[G/T]
TTCAGGTTTATTGTGTAAACAAAGCAACGGAGTTGTATATCTTGATAAAAATTTGCCAAAACCAGATTACAGCACTTGTGCACGACTCACCTTTTTTTTC
GAAAAAAAAGGTGAGTCGTGCACAAGTGCTGTAATCTGGTTTTGGCAAATTTTTATCAAGATATACAACTCCGTTGCTTTGTTTACACAATAAACCTGAA[C/A]
TCTAGGTGTAGCAGCTTGAAGCATTAAAAAAGAAGATGGCAGCAAACAGATGTTTGCTTTATTGGATTTAATACTTGGATATTCCACTGTGCTTCCCAAA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 53.10% | 0.50% | 14.73% | 31.72% | NA |
| All Indica | 2759 | 24.30% | 0.80% | 23.23% | 51.69% | NA |
| All Japonica | 1512 | 99.50% | 0.00% | 0.20% | 0.26% | NA |
| Aus | 269 | 71.00% | 0.40% | 12.27% | 16.36% | NA |
| Indica I | 595 | 5.40% | 0.70% | 15.46% | 78.49% | NA |
| Indica II | 465 | 24.10% | 0.00% | 18.71% | 57.20% | NA |
| Indica III | 913 | 35.70% | 1.40% | 30.12% | 32.75% | NA |
| Indica Intermediate | 786 | 25.40% | 0.60% | 23.79% | 50.13% | NA |
| Temperate Japonica | 767 | 99.70% | 0.00% | 0.13% | 0.13% | NA |
| Tropical Japonica | 504 | 99.60% | 0.00% | 0.00% | 0.40% | NA |
| Japonica Intermediate | 241 | 98.80% | 0.00% | 0.83% | 0.41% | NA |
| VI/Aromatic | 96 | 94.80% | 0.00% | 5.21% | 0.00% | NA |
| Intermediate | 90 | 56.70% | 0.00% | 15.56% | 27.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0334626484 | G -> T | LOC_Os03g60939.1 | upstream_gene_variant ; 4261.0bp to feature; MODIFIER | silent_mutation | Average:12.376; most accessible tissue: Minghui63 panicle, score: 25.313 | N | N | N | N |
| vg0334626484 | G -> T | LOC_Os03g60930.1 | downstream_gene_variant ; 1031.0bp to feature; MODIFIER | silent_mutation | Average:12.376; most accessible tissue: Minghui63 panicle, score: 25.313 | N | N | N | N |
| vg0334626484 | G -> T | LOC_Os03g60930-LOC_Os03g60939 | intergenic_region ; MODIFIER | silent_mutation | Average:12.376; most accessible tissue: Minghui63 panicle, score: 25.313 | N | N | N | N |
| vg0334626484 | G -> DEL | N | N | silent_mutation | Average:12.376; most accessible tissue: Minghui63 panicle, score: 25.313 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0334626484 | NA | 1.86E-08 | mr1519 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0334626484 | NA | 6.25E-13 | mr1519_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |