Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0334580739:

Variant ID: vg0334580739 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 34580739
Reference Allele: A	Alternative Allele: C
Primary Allele: A	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.92, A: 0.08, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:

GTCAATAGTTTGAAATAAGTTTTCAAGCAATGAGTACAATGTTCAAAAAAAAAAAAAAGCAATGAGTACTACTGGAAAGTTTTTTCTAAGCAAATACTCC[A/C]
TCCGTCTCTAAATATTTGACGTTGTTAACTTTTTTAAACATGTTTGACCGTTCGTCTTATTTAAAAAATTTAAGTAATTATTAATTCTTTTCCTATCATT

Reverse complement sequence

AATGATAGGAAAAGAATTAATAATTACTTAAATTTTTTAAATAAGACGAACGGTCAAACATGTTTAAAAAAGTTAACAACGTCAAATATTTAGAGACGGA[T/G]
GGAGTATTTGCTTAGAAAAAACTTTCCAGTAGTACTCATTGCTTTTTTTTTTTTTTGAACATTGTACTCATTGCTTGAAAACTTATTTCAAACTATTGAC

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	79.40%	15.60%	0.34%	4.61%	NA
All Indica	2759	69.70%	22.30%	0.36%	7.72%	NA
All Japonica	1512	99.50%	0.30%	0.07%	0.20%	NA
Aus	269	61.70%	37.90%	0.37%	0.00%	NA
Indica I	595	91.30%	8.70%	0.00%	0.00%	NA
Indica II	465	77.20%	20.20%	0.43%	2.15%	NA
Indica III	913	54.10%	27.70%	0.66%	17.52%	NA
Indica Intermediate	786	66.90%	27.40%	0.25%	5.47%	NA
Temperate Japonica	767	99.60%	0.30%	0.00%	0.13%	NA
Tropical Japonica	504	99.20%	0.40%	0.00%	0.40%	NA
Japonica Intermediate	241	99.60%	0.00%	0.41%	0.00%	NA
VI/Aromatic	96	91.70%	5.20%	3.12%	0.00%	NA
Intermediate	90	82.20%	14.40%	1.11%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0334580739	A -> C	LOC_Os03g60850.1	upstream_gene_variant ; 3766.0bp to feature; MODIFIER	silent_mutation	Average:50.392; most accessible tissue: Callus, score: 81.426	N	N	N	N
vg0334580739	A -> C	LOC_Os03g60850-LOC_Os03g60870	intergenic_region ; MODIFIER	silent_mutation	Average:50.392; most accessible tissue: Callus, score: 81.426	N	N	N	N
vg0334580739	A -> DEL	N	N	silent_mutation	Average:50.392; most accessible tissue: Callus, score: 81.426	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0334580739	8.97E-08	NA	mr1671	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334580739	5.66E-09	2.98E-10	mr1671	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334580739	3.04E-14	NA	mr1671_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334580739	1.96E-15	1.18E-16	mr1671_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251