\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0334568723:

Variant ID: vg0334568723 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 34568723
Reference Allele: GAlternative Allele: T,A
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 259. )

Flanking Sequence (100 bp) in Reference Genome:


CACTTAGGTTGTGTTCAGTAGCTTCAGATGGGACCTAAGAGCCAGTACAACAGCATACTATAAGCCAACTATTAACACATATCGAGTAGATAAATAAGAA[G/T,A]
AGAGAAGAGCAGCGGGCTATAAATTTGTACCTAGATTATAAAATATAATGTGTGTTTGACAGGTAGGACCAGATATTACTAGTGTTGTATATGTTTATAG

Reverse complement sequence

CTATAAACATATACAACACTAGTAATATCTGGTCCTACCTGTCAAACACACATTATATTTTATAATCTAGGTACAAATTTATAGCCCGCTGCTCTTCTCT[C/A,T]
TTCTTATTTATCTACTCGATATGTGTTAATAGTTGGCTTATAGTATGCTGTTGTACTGGCTCTTAGGTCCCATCTGAAGCTACTGAACACAACCTAAGTG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 88.90% 10.10% 0.97% 0.00% NA
All Indica  2759 99.80% 0.10% 0.04% 0.00% NA
All Japonica  1512 67.30% 29.80% 2.91% 0.00% NA
Aus  269 99.60% 0.00% 0.37% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.80% 0.20% 0.00% 0.00% NA
Indica III  913 99.80% 0.20% 0.00% 0.00% NA
Indica Intermediate  786 99.70% 0.10% 0.13% 0.00% NA
Temperate Japonica  767 76.30% 19.40% 4.30% 0.00% NA
Tropical Japonica  504 45.00% 53.80% 1.19% 0.00% NA
Japonica Intermediate  241 85.10% 12.90% 2.07% 0.00% NA
VI/Aromatic  96 94.80% 5.20% 0.00% 0.00% NA
Intermediate  90 81.10% 18.90% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0334568723 G -> T LOC_Os03g60830.1 upstream_gene_variant ; 4050.0bp to feature; MODIFIER silent_mutation Average:68.548; most accessible tissue: Callus, score: 80.978 N N N N
vg0334568723 G -> T LOC_Os03g60840.1 upstream_gene_variant ; 636.0bp to feature; MODIFIER silent_mutation Average:68.548; most accessible tissue: Callus, score: 80.978 N N N N
vg0334568723 G -> T LOC_Os03g60840-LOC_Os03g60850 intergenic_region ; MODIFIER silent_mutation Average:68.548; most accessible tissue: Callus, score: 80.978 N N N N
vg0334568723 G -> A LOC_Os03g60830.1 upstream_gene_variant ; 4050.0bp to feature; MODIFIER N Average:68.548; most accessible tissue: Callus, score: 80.978 N N N N
vg0334568723 G -> A LOC_Os03g60840.1 upstream_gene_variant ; 636.0bp to feature; MODIFIER N Average:68.548; most accessible tissue: Callus, score: 80.978 N N N N
vg0334568723 G -> A LOC_Os03g60840-LOC_Os03g60850 intergenic_region ; MODIFIER N Average:68.548; most accessible tissue: Callus, score: 80.978 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0334568723 NA 5.67E-12 Plant_height Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0334568723 NA 1.62E-06 mr1002 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334568723 NA 6.36E-06 mr1092 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334568723 NA 2.41E-09 mr1097 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334568723 1.02E-07 NA mr1002_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334568723 NA 6.37E-10 mr1002_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334568723 NA 8.56E-06 mr1164_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334568723 5.76E-06 5.76E-06 mr1430_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334568723 NA 2.98E-08 mr1709_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251