\
| Variant ID: vg0334568723 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 34568723 |
| Reference Allele: G | Alternative Allele: T,A |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 259. )
CACTTAGGTTGTGTTCAGTAGCTTCAGATGGGACCTAAGAGCCAGTACAACAGCATACTATAAGCCAACTATTAACACATATCGAGTAGATAAATAAGAA[G/T,A]
AGAGAAGAGCAGCGGGCTATAAATTTGTACCTAGATTATAAAATATAATGTGTGTTTGACAGGTAGGACCAGATATTACTAGTGTTGTATATGTTTATAG
CTATAAACATATACAACACTAGTAATATCTGGTCCTACCTGTCAAACACACATTATATTTTATAATCTAGGTACAAATTTATAGCCCGCTGCTCTTCTCT[C/A,T]
TTCTTATTTATCTACTCGATATGTGTTAATAGTTGGCTTATAGTATGCTGTTGTACTGGCTCTTAGGTCCCATCTGAAGCTACTGAACACAACCTAAGTG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 88.90% | 10.10% | 0.97% | 0.00% | NA |
| All Indica | 2759 | 99.80% | 0.10% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 67.30% | 29.80% | 2.91% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.00% | 0.37% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.70% | 0.10% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 76.30% | 19.40% | 4.30% | 0.00% | NA |
| Tropical Japonica | 504 | 45.00% | 53.80% | 1.19% | 0.00% | NA |
| Japonica Intermediate | 241 | 85.10% | 12.90% | 2.07% | 0.00% | NA |
| VI/Aromatic | 96 | 94.80% | 5.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 81.10% | 18.90% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0334568723 | G -> T | LOC_Os03g60830.1 | upstream_gene_variant ; 4050.0bp to feature; MODIFIER | silent_mutation | Average:68.548; most accessible tissue: Callus, score: 80.978 | N | N | N | N |
| vg0334568723 | G -> T | LOC_Os03g60840.1 | upstream_gene_variant ; 636.0bp to feature; MODIFIER | silent_mutation | Average:68.548; most accessible tissue: Callus, score: 80.978 | N | N | N | N |
| vg0334568723 | G -> T | LOC_Os03g60840-LOC_Os03g60850 | intergenic_region ; MODIFIER | silent_mutation | Average:68.548; most accessible tissue: Callus, score: 80.978 | N | N | N | N |
| vg0334568723 | G -> A | LOC_Os03g60830.1 | upstream_gene_variant ; 4050.0bp to feature; MODIFIER | N | Average:68.548; most accessible tissue: Callus, score: 80.978 | N | N | N | N |
| vg0334568723 | G -> A | LOC_Os03g60840.1 | upstream_gene_variant ; 636.0bp to feature; MODIFIER | N | Average:68.548; most accessible tissue: Callus, score: 80.978 | N | N | N | N |
| vg0334568723 | G -> A | LOC_Os03g60840-LOC_Os03g60850 | intergenic_region ; MODIFIER | N | Average:68.548; most accessible tissue: Callus, score: 80.978 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0334568723 | NA | 5.67E-12 | Plant_height | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0334568723 | NA | 1.62E-06 | mr1002 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0334568723 | NA | 6.36E-06 | mr1092 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0334568723 | NA | 2.41E-09 | mr1097 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0334568723 | 1.02E-07 | NA | mr1002_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0334568723 | NA | 6.37E-10 | mr1002_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0334568723 | NA | 8.56E-06 | mr1164_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0334568723 | 5.76E-06 | 5.76E-06 | mr1430_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0334568723 | NA | 2.98E-08 | mr1709_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |