Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0334568723:

Variant ID: vg0334568723 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 34568723
Reference Allele: G	Alternative Allele: T,A
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 259. )

Flanking Sequence (100 bp) in Reference Genome:

CACTTAGGTTGTGTTCAGTAGCTTCAGATGGGACCTAAGAGCCAGTACAACAGCATACTATAAGCCAACTATTAACACATATCGAGTAGATAAATAAGAA[G/T,A]
AGAGAAGAGCAGCGGGCTATAAATTTGTACCTAGATTATAAAATATAATGTGTGTTTGACAGGTAGGACCAGATATTACTAGTGTTGTATATGTTTATAG

Reverse complement sequence

CTATAAACATATACAACACTAGTAATATCTGGTCCTACCTGTCAAACACACATTATATTTTATAATCTAGGTACAAATTTATAGCCCGCTGCTCTTCTCT[C/A,T]
TTCTTATTTATCTACTCGATATGTGTTAATAGTTGGCTTATAGTATGCTGTTGTACTGGCTCTTAGGTCCCATCTGAAGCTACTGAACACAACCTAAGTG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	88.90%	10.10%	0.97%	0.00%	NA
All Indica	2759	99.80%	0.10%	0.04%	0.00%	NA
All Japonica	1512	67.30%	29.80%	2.91%	0.00%	NA
Aus	269	99.60%	0.00%	0.37%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	99.80%	0.20%	0.00%	0.00%	NA
Indica III	913	99.80%	0.20%	0.00%	0.00%	NA
Indica Intermediate	786	99.70%	0.10%	0.13%	0.00%	NA
Temperate Japonica	767	76.30%	19.40%	4.30%	0.00%	NA
Tropical Japonica	504	45.00%	53.80%	1.19%	0.00%	NA
Japonica Intermediate	241	85.10%	12.90%	2.07%	0.00%	NA
VI/Aromatic	96	94.80%	5.20%	0.00%	0.00%	NA
Intermediate	90	81.10%	18.90%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0334568723	G -> T	LOC_Os03g60830.1	upstream_gene_variant ; 4050.0bp to feature; MODIFIER	silent_mutation	Average:68.548; most accessible tissue: Callus, score: 80.978	N	N	N	N
vg0334568723	G -> T	LOC_Os03g60840.1	upstream_gene_variant ; 636.0bp to feature; MODIFIER	silent_mutation	Average:68.548; most accessible tissue: Callus, score: 80.978	N	N	N	N
vg0334568723	G -> T	LOC_Os03g60840-LOC_Os03g60850	intergenic_region ; MODIFIER	silent_mutation	Average:68.548; most accessible tissue: Callus, score: 80.978	N	N	N	N
vg0334568723	G -> A	LOC_Os03g60830.1	upstream_gene_variant ; 4050.0bp to feature; MODIFIER	N	Average:68.548; most accessible tissue: Callus, score: 80.978	N	N	N	N
vg0334568723	G -> A	LOC_Os03g60840.1	upstream_gene_variant ; 636.0bp to feature; MODIFIER	N	Average:68.548; most accessible tissue: Callus, score: 80.978	N	N	N	N
vg0334568723	G -> A	LOC_Os03g60840-LOC_Os03g60850	intergenic_region ; MODIFIER	N	Average:68.548; most accessible tissue: Callus, score: 80.978	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0334568723	NA	5.67E-12	Plant_height	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0334568723	NA	1.62E-06	mr1002	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334568723	NA	6.36E-06	mr1092	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334568723	NA	2.41E-09	mr1097	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334568723	1.02E-07	NA	mr1002_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334568723	NA	6.37E-10	mr1002_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334568723	NA	8.56E-06	mr1164_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334568723	5.76E-06	5.76E-06	mr1430_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334568723	NA	2.98E-08	mr1709_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251