Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0334564078:

Variant ID: vg0334564078 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 34564078
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AAGAGGCCCCAGTACCGAAGATCCCGGCTGCGAATCCTGCTGGACAAGGACCATCAGTTTCGTACAAGTATTTAACAGTAGTAATAAAAAGTAAAGTCCA[G/A]
AGAAGTCCTCATTTGCCCAATCAGTGGCCATTACATCACCTTCCTCATCGGATGATGCGTCGTCGTCCGCTTCCTCATTATCCGAATCTTCCCTCTCCAT

Reverse complement sequence

ATGGAGAGGGAAGATTCGGATAATGAGGAAGCGGACGACGACGCATCATCCGATGAGGAAGGTGATGTAATGGCCACTGATTGGGCAAATGAGGACTTCT[C/T]
TGGACTTTACTTTTTATTACTACTGTTAAATACTTGTACGAAACTGATGGTCCTTGTCCAGCAGGATTCGCAGCCGGGATCTTCGGTACTGGGGCCTCTT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	39.90%	10.20%	12.76%	37.22%	NA
All Indica	2759	17.80%	5.40%	19.83%	56.98%	NA
All Japonica	1512	77.30%	20.40%	1.65%	0.66%	NA
Aus	269	40.10%	0.00%	7.43%	52.42%	NA
Indica I	595	19.50%	0.00%	32.10%	48.40%	NA
Indica II	465	36.60%	2.20%	27.10%	34.19%	NA
Indica III	913	4.60%	12.60%	7.67%	75.14%	NA
Indica Intermediate	786	20.90%	2.90%	20.36%	55.85%	NA
Temperate Japonica	767	96.20%	0.90%	1.83%	1.04%	NA
Tropical Japonica	504	44.20%	54.20%	1.19%	0.40%	NA
Japonica Intermediate	241	86.30%	11.60%	2.07%	0.00%	NA
VI/Aromatic	96	84.40%	6.20%	3.12%	6.25%	NA
Intermediate	90	37.80%	20.00%	8.89%	33.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0334564078	G -> A	LOC_Os03g60820.1	upstream_gene_variant ; 3254.0bp to feature; MODIFIER	silent_mutation	Average:17.008; most accessible tissue: Minghui63 young leaf, score: 23.613	N	N	N	N
vg0334564078	G -> A	LOC_Os03g60840.1	downstream_gene_variant ; 2910.0bp to feature; MODIFIER	silent_mutation	Average:17.008; most accessible tissue: Minghui63 young leaf, score: 23.613	N	N	N	N
vg0334564078	G -> A	LOC_Os03g60830.1	intron_variant ; MODIFIER	silent_mutation	Average:17.008; most accessible tissue: Minghui63 young leaf, score: 23.613	N	N	N	N
vg0334564078	G -> DEL	N	N	silent_mutation	Average:17.008; most accessible tissue: Minghui63 young leaf, score: 23.613	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0334564078	NA	1.86E-06	mr1045	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334564078	NA	7.81E-08	mr1418	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334564078	NA	1.76E-07	mr1420	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334564078	NA	4.10E-06	mr1425	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334564078	NA	1.70E-06	mr1492	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334564078	NA	7.76E-06	mr1596	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334564078	NA	1.82E-08	mr1668	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334564078	NA	3.47E-07	mr1802	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334564078	4.72E-06	4.72E-06	mr1802	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334564078	NA	9.81E-07	mr1812	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251