\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0334560863:

Variant ID: vg0334560863 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 34560863
Reference Allele: TAlternative Allele: G
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.95, T: 0.06, others allele: 0.00, population size: 222. )

Flanking Sequence (100 bp) in Reference Genome:


AAGCCAACGCGCCCACCAAGTGCAATGTGGGCCATTGGCCTAGGCCACGAGCCTTCCTGATCGCCCGTTGACCCCGTCCAGGTAAGTATGGAGCAACGGA[T/G]
CTCGGGGTTCTGTACTTATACCGAAAGAGCACCAGGCAATCGACGCAAACTTTCGAGGTGGTACTAATGTGGAGCAACGCAGAGTTCTTTTCGGTTTCCA

Reverse complement sequence

TGGAAACCGAAAAGAACTCTGCGTTGCTCCACATTAGTACCACCTCGAAAGTTTGCGTCGATTGCCTGGTGCTCTTTCGGTATAAGTACAGAACCCCGAG[A/C]
TCCGTTGCTCCATACTTACCTGGACGGGGTCAACGGGCGATCAGGAAGGCTCGTGGCCTAGGCCAATGGCCCACATTGCACTTGGTGGGCGCGTTGGCTT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 57.30% 40.30% 1.16% 1.23% NA
All Indica  2759 93.10% 6.30% 0.47% 0.11% NA
All Japonica  1512 1.10% 98.80% 0.00% 0.13% NA
Aus  269 27.10% 39.80% 14.87% 18.22% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 94.20% 4.10% 1.72% 0.00% NA
Indica III  913 88.30% 11.50% 0.11% 0.11% NA
Indica Intermediate  786 92.70% 6.50% 0.51% 0.25% NA
Temperate Japonica  767 1.20% 98.60% 0.00% 0.26% NA
Tropical Japonica  504 1.00% 99.00% 0.00% 0.00% NA
Japonica Intermediate  241 0.80% 99.20% 0.00% 0.00% NA
VI/Aromatic  96 7.30% 89.60% 1.04% 2.08% NA
Intermediate  90 48.90% 47.80% 1.11% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0334560863 T -> DEL N N silent_mutation Average:98.657; most accessible tissue: Zhenshan97 root, score: 99.683 N N N N
vg0334560863 T -> G LOC_Os03g60820.1 upstream_gene_variant ; 39.0bp to feature; MODIFIER silent_mutation Average:98.657; most accessible tissue: Zhenshan97 root, score: 99.683 N N N N
vg0334560863 T -> G LOC_Os03g60830.1 downstream_gene_variant ; 2585.0bp to feature; MODIFIER silent_mutation Average:98.657; most accessible tissue: Zhenshan97 root, score: 99.683 N N N N
vg0334560863 T -> G LOC_Os03g60820-LOC_Os03g60830 intergenic_region ; MODIFIER silent_mutation Average:98.657; most accessible tissue: Zhenshan97 root, score: 99.683 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0334560863 T G 0.02 0.01 0.02 0.01 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0334560863 3.77E-06 1.49E-27 mr1037 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334560863 NA 4.45E-31 mr1448 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334560863 NA 5.04E-42 mr1591 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334560863 NA 1.20E-39 mr1890 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334560863 NA 4.70E-40 mr1891 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334560863 NA 3.01E-33 mr1037_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334560863 NA 3.50E-34 mr1181_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334560863 NA 3.81E-07 mr1205_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334560863 NA 1.32E-23 mr1386_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334560863 NA 1.47E-32 mr1723_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251