\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0334513208:

Variant ID: vg0334513208 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 34513208
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.02, others allele: 0.00, population size: 250. )

Flanking Sequence (100 bp) in Reference Genome:


TCTTATTGGCACATTTTGGTAGCAAACCAAACACTAGCCAAACTACTATTCAAAATGCCAACAATTTGGTAGTGCATATTTTGACATCAAACCAAATTGG[C/T]
CCTAAATATTTTTGGTAGCATCTGTGTGATATAAGTAAGTATTGGTAGCAAACCAAATATTACCAGGCTACTATTGTTTAATTTGCCAATATCTTGGTAG

Reverse complement sequence

CTACCAAGATATTGGCAAATTAAACAATAGTAGCCTGGTAATATTTGGTTTGCTACCAATACTTACTTATATCACACAGATGCTACCAAAAATATTTAGG[G/A]
CCAATTTGGTTTGATGTCAAAATATGCACTACCAAATTGTTGGCATTTTGAATAGTAGTTTGGCTAGTGTTTGGTTTGCTACCAAAATGTGCCAATAAGA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 57.60% 42.30% 0.15% 0.00% NA
All Indica  2759 31.10% 68.70% 0.14% 0.00% NA
All Japonica  1512 99.10% 0.90% 0.00% 0.00% NA
Aus  269 79.20% 20.80% 0.00% 0.00% NA
Indica I  595 3.20% 96.80% 0.00% 0.00% NA
Indica II  465 22.40% 77.40% 0.22% 0.00% NA
Indica III  913 50.90% 48.80% 0.22% 0.00% NA
Indica Intermediate  786 34.50% 65.40% 0.13% 0.00% NA
Temperate Japonica  767 98.80% 1.20% 0.00% 0.00% NA
Tropical Japonica  504 99.40% 0.60% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 61.10% 35.60% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0334513208 C -> T LOC_Os03g60720.1 upstream_gene_variant ; 1929.0bp to feature; MODIFIER silent_mutation Average:46.825; most accessible tissue: Callus, score: 78.918 N N N N
vg0334513208 C -> T LOC_Os03g60720-LOC_Os03g60730 intergenic_region ; MODIFIER silent_mutation Average:46.825; most accessible tissue: Callus, score: 78.918 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0334513208 NA 1.80E-10 mr1770 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334513208 5.13E-06 NA mr1134_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334513208 NA 3.55E-07 mr1212_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334513208 NA 1.67E-07 mr1612_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334513208 NA 3.30E-09 mr1649_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251