\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0334445299:

Variant ID: vg0334445299 (JBrowse)Variation Type: INDEL
Chromosome: chr03Position: 34445299
Reference Allele: TAlternative Allele: A,TGTA
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CAGTCACGTGACACGACACTAGCCAAAGGGTTTCATTGATTACGCAGAAGGTGACTATAAGCCACAACGTCTATTAAAAAAAACTGCATGTAAAACTTTT[T/A,TGTA]
TATATGCATTCTTAGCGATTTAAAAGATACTCCATCCTTTTCAGGTTTTAAGACATTTTGACTTCAGTCAAAGACAAACTGTTTTAAGTTTGACTAAGTT

Reverse complement sequence

AACTTAGTCAAACTTAAAACAGTTTGTCTTTGACTGAAGTCAAAATGTCTTAAAACCTGAAAAGGATGGAGTATCTTTTAAATCGCTAAGAATGCATATA[A/T,TACA]
AAAAGTTTTACATGCAGTTTTTTTTAATAGACGTTGTGGCTTATAGTCACCTTCTGCGTAATCAATGAAACCCTTTGGCTAGTGTCGTGTCACGTGACTG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 92.90% 5.60% 0.02% 0.00% TGTA: 1.52%
All Indica  2759 96.90% 0.80% 0.04% 0.00% TGTA: 2.28%
All Japonica  1512 98.70% 1.30% 0.00% 0.00% TGTA: 0.07%
Aus  269 17.80% 81.00% 0.00% 0.00% TGTA: 1.12%
Indica I  595 99.80% 0.00% 0.00% 0.00% TGTA: 0.17%
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 95.00% 0.70% 0.00% 0.00% TGTA: 4.38%
Indica Intermediate  786 95.20% 1.90% 0.13% 0.00% TGTA: 2.80%
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 96.40% 3.60% 0.00% 0.00% NA
Japonica Intermediate  241 99.20% 0.40% 0.00% 0.00% TGTA: 0.41%
VI/Aromatic  96 92.70% 3.10% 0.00% 0.00% TGTA: 4.17%
Intermediate  90 95.60% 3.30% 0.00% 0.00% TGTA: 1.11%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0334445299 T -> A LOC_Os03g60610.1 upstream_gene_variant ; 858.0bp to feature; MODIFIER silent_mutation Average:65.242; most accessible tissue: Callus, score: 91.825 N N N N
vg0334445299 T -> A LOC_Os03g60620.1 upstream_gene_variant ; 1024.0bp to feature; MODIFIER silent_mutation Average:65.242; most accessible tissue: Callus, score: 91.825 N N N N
vg0334445299 T -> A LOC_Os03g60610.2 upstream_gene_variant ; 866.0bp to feature; MODIFIER silent_mutation Average:65.242; most accessible tissue: Callus, score: 91.825 N N N N
vg0334445299 T -> A LOC_Os03g60610.3 upstream_gene_variant ; 866.0bp to feature; MODIFIER silent_mutation Average:65.242; most accessible tissue: Callus, score: 91.825 N N N N
vg0334445299 T -> A LOC_Os03g60610-LOC_Os03g60620 intergenic_region ; MODIFIER silent_mutation Average:65.242; most accessible tissue: Callus, score: 91.825 N N N N
vg0334445299 T -> TGTA LOC_Os03g60610.1 upstream_gene_variant ; 859.0bp to feature; MODIFIER silent_mutation Average:65.242; most accessible tissue: Callus, score: 91.825 N N N N
vg0334445299 T -> TGTA LOC_Os03g60620.1 upstream_gene_variant ; 1023.0bp to feature; MODIFIER silent_mutation Average:65.242; most accessible tissue: Callus, score: 91.825 N N N N
vg0334445299 T -> TGTA LOC_Os03g60610.2 upstream_gene_variant ; 867.0bp to feature; MODIFIER silent_mutation Average:65.242; most accessible tissue: Callus, score: 91.825 N N N N
vg0334445299 T -> TGTA LOC_Os03g60610.3 upstream_gene_variant ; 867.0bp to feature; MODIFIER silent_mutation Average:65.242; most accessible tissue: Callus, score: 91.825 N N N N
vg0334445299 T -> TGTA LOC_Os03g60610-LOC_Os03g60620 intergenic_region ; MODIFIER silent_mutation Average:65.242; most accessible tissue: Callus, score: 91.825 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0334445299 T A 0.0 0.0 -0.01 -0.02 -0.02 -0.02
vg0334445299 T TGTA -0.12 0.02 0.08 -0.14 -0.04 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0334445299 NA 5.42E-06 mr1006 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334445299 NA 5.03E-06 mr1052 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334445299 NA 1.95E-06 mr1126 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334445299 5.30E-07 NA mr1151 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334445299 NA 2.39E-16 mr1158 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334445299 NA 2.32E-13 mr1166 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334445299 NA 3.33E-06 mr1230 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334445299 4.25E-07 NA mr1248 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334445299 6.37E-09 NA mr1249 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334445299 3.61E-07 NA mr1263 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334445299 NA 1.81E-06 mr1345 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334445299 NA 4.02E-06 mr1427 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334445299 NA 4.11E-08 mr1446 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334445299 3.61E-07 NA mr1451 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334445299 NA 3.69E-08 mr1465 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334445299 NA 1.17E-18 mr1515 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334445299 NA 5.24E-06 mr1634 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334445299 NA 4.76E-06 mr1665 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334445299 NA 2.90E-10 mr1696 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334445299 NA 5.26E-08 mr1706 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334445299 NA 3.81E-10 mr1927 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334445299 NA 6.28E-08 mr1989 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334445299 4.69E-09 NA mr1151_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334445299 1.99E-12 NA mr1248_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334445299 1.08E-08 NA mr1263_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334445299 NA 3.11E-22 mr1305_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334445299 NA 1.67E-12 mr1409_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334445299 NA 5.00E-15 mr1530_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334445299 NA 1.01E-09 mr1649_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334445299 NA 4.00E-06 mr1815_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251