\
| Variant ID: vg0334402323 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 34402323 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.03, others allele: 0.00, population size: 70. )
CACATCGAGAAACAAAAAAGACAAATTTAGATATAAACAGTACGCTACTATTCATACGCTAAATTTGTCTTTTTTATATCTCGATGTGTGAGTTGAGTTT[G/A]
GACTTAAGATTTTGTGAAGTTGTATATATGTGTTGTATGAATGTTGTCAAATTTTTCCAGAATTTTTCATAACCATTTAGATGGTTTTTGAGTAAACGAG
CTCGTTTACTCAAAAACCATCTAAATGGTTATGAAAAATTCTGGAAAAATTTGACAACATTCATACAACACATATATACAACTTCACAAAATCTTAAGTC[C/T]
AAACTCAACTCACACATCGAGATATAAAAAAGACAAATTTAGCGTATGAATAGTAGCGTACTGTTTATATCTAAATTTGTCTTTTTTGTTTCTCGATGTG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 84.60% | 13.90% | 0.11% | 1.44% | NA |
| All Indica | 2759 | 82.80% | 14.90% | 0.14% | 2.17% | NA |
| All Japonica | 1512 | 98.70% | 1.20% | 0.00% | 0.07% | NA |
| Aus | 269 | 20.40% | 78.40% | 0.37% | 0.74% | NA |
| Indica I | 595 | 98.70% | 1.20% | 0.00% | 0.17% | NA |
| Indica II | 465 | 85.40% | 14.60% | 0.00% | 0.00% | NA |
| Indica III | 913 | 75.70% | 19.80% | 0.22% | 4.27% | NA |
| Indica Intermediate | 786 | 77.50% | 19.70% | 0.25% | 2.54% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 96.40% | 3.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.00% | 0.00% | 0.41% | NA |
| VI/Aromatic | 96 | 92.70% | 3.10% | 0.00% | 4.17% | NA |
| Intermediate | 90 | 85.60% | 13.30% | 0.00% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0334402323 | G -> A | LOC_Os03g60520.1 | upstream_gene_variant ; 2046.0bp to feature; MODIFIER | silent_mutation | Average:56.259; most accessible tissue: Zhenshan97 flower, score: 76.324 | N | N | N | N |
| vg0334402323 | G -> A | LOC_Os03g60530.1 | upstream_gene_variant ; 4770.0bp to feature; MODIFIER | silent_mutation | Average:56.259; most accessible tissue: Zhenshan97 flower, score: 76.324 | N | N | N | N |
| vg0334402323 | G -> A | LOC_Os03g60530.3 | upstream_gene_variant ; 4770.0bp to feature; MODIFIER | silent_mutation | Average:56.259; most accessible tissue: Zhenshan97 flower, score: 76.324 | N | N | N | N |
| vg0334402323 | G -> A | LOC_Os03g60524.1 | downstream_gene_variant ; 2439.0bp to feature; MODIFIER | silent_mutation | Average:56.259; most accessible tissue: Zhenshan97 flower, score: 76.324 | N | N | N | N |
| vg0334402323 | G -> A | LOC_Os03g60520-LOC_Os03g60524 | intergenic_region ; MODIFIER | silent_mutation | Average:56.259; most accessible tissue: Zhenshan97 flower, score: 76.324 | N | N | N | N |
| vg0334402323 | G -> DEL | N | N | silent_mutation | Average:56.259; most accessible tissue: Zhenshan97 flower, score: 76.324 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0334402323 | NA | 9.34E-06 | mr1114 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0334402323 | 4.19E-06 | 2.56E-06 | mr1117 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0334402323 | NA | 3.44E-14 | mr1166 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0334402323 | 4.94E-06 | NA | mr1249 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0334402323 | NA | 8.24E-06 | mr1314 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0334402323 | NA | 2.82E-07 | mr1392 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0334402323 | NA | 2.32E-06 | mr1474 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0334402323 | NA | 2.32E-06 | mr1475 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0334402323 | NA | 7.45E-07 | mr1665 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0334402323 | 9.30E-06 | NA | mr1671 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0334402323 | NA | 4.93E-10 | mr1730 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0334402323 | NA | 1.24E-07 | mr1765_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |