\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0334386865:

Variant ID: vg0334386865 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 34386865
Reference Allele: GAlternative Allele: T,A
Primary Allele: TSecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TATATCTAGATTCGGAGTAATAGGATGTGTCACATTCAACCAAAATATCTTATATTATGTGACGGAGAGAGTAATTATAAAGGGTGAGGCTTCGAATCCA[G/T,A]
GTCGTCTAGCCCATCCCATTGTAGAGCTAGTCGGAAAAACTCTAGGGGTTTCTCTGTTCATGCATACATATTACAATGGGCATCTTTAATTTATCTTCAG

Reverse complement sequence

CTGAAGATAAATTAAAGATGCCCATTGTAATATGTATGCATGAACAGAGAAACCCCTAGAGTTTTTCCGACTAGCTCTACAATGGGATGGGCTAGACGAC[C/A,T]
TGGATTCGAAGCCTCACCCTTTATAATTACTCTCTCCGTCACATAATATAAGATATTTTGGTTGAATGTGACACATCCTATTACTCCGAATCTAGATATA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 50.10% 47.80% 0.28% 0.30% A: 1.61%
All Indica  2759 82.10% 14.70% 0.29% 0.47% A: 2.46%
All Japonica  1512 0.70% 99.20% 0.00% 0.00% A: 0.07%
Aus  269 19.70% 79.20% 0.37% 0.00% A: 0.74%
Indica I  595 91.40% 7.10% 0.17% 1.18% A: 0.17%
Indica II  465 95.10% 3.20% 1.08% 0.22% A: 0.43%
Indica III  913 74.60% 21.00% 0.00% 0.00% A: 4.38%
Indica Intermediate  786 76.10% 19.80% 0.25% 0.64% A: 3.18%
Temperate Japonica  767 0.50% 99.50% 0.00% 0.00% NA
Tropical Japonica  504 1.20% 98.80% 0.00% 0.00% NA
Japonica Intermediate  241 0.40% 99.20% 0.00% 0.00% A: 0.41%
VI/Aromatic  96 1.00% 94.80% 0.00% 0.00% A: 4.17%
Intermediate  90 40.00% 53.30% 4.44% 1.11% A: 1.11%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0334386865 G -> T LOC_Os03g60460.1 downstream_gene_variant ; 4504.0bp to feature; MODIFIER silent_mutation Average:74.006; most accessible tissue: Minghui63 panicle, score: 96.065 N N N N
vg0334386865 G -> T LOC_Os03g60470.1 downstream_gene_variant ; 2504.0bp to feature; MODIFIER silent_mutation Average:74.006; most accessible tissue: Minghui63 panicle, score: 96.065 N N N N
vg0334386865 G -> T LOC_Os03g60500.1 downstream_gene_variant ; 4566.0bp to feature; MODIFIER silent_mutation Average:74.006; most accessible tissue: Minghui63 panicle, score: 96.065 N N N N
vg0334386865 G -> T LOC_Os03g60480.1 intron_variant ; MODIFIER silent_mutation Average:74.006; most accessible tissue: Minghui63 panicle, score: 96.065 N N N N
vg0334386865 G -> A LOC_Os03g60460.1 downstream_gene_variant ; 4504.0bp to feature; MODIFIER silent_mutation Average:74.006; most accessible tissue: Minghui63 panicle, score: 96.065 N N N N
vg0334386865 G -> A LOC_Os03g60470.1 downstream_gene_variant ; 2504.0bp to feature; MODIFIER silent_mutation Average:74.006; most accessible tissue: Minghui63 panicle, score: 96.065 N N N N
vg0334386865 G -> A LOC_Os03g60500.1 downstream_gene_variant ; 4566.0bp to feature; MODIFIER silent_mutation Average:74.006; most accessible tissue: Minghui63 panicle, score: 96.065 N N N N
vg0334386865 G -> A LOC_Os03g60480.1 intron_variant ; MODIFIER silent_mutation Average:74.006; most accessible tissue: Minghui63 panicle, score: 96.065 N N N N
vg0334386865 G -> DEL N N silent_mutation Average:74.006; most accessible tissue: Minghui63 panicle, score: 96.065 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0334386865 G A 0.01 0.0 0.01 -0.02 0.0 0.0
vg0334386865 G T -0.02 -0.01 -0.01 0.01 0.0 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0334386865 NA 1.29E-21 mr1003 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334386865 NA 4.87E-32 mr1037 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334386865 NA 4.52E-06 mr1037 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334386865 NA 3.32E-22 mr1051 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334386865 NA 7.22E-44 mr1458 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334386865 NA 1.30E-09 mr1524 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334386865 NA 7.77E-59 mr1671 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334386865 NA 2.35E-34 mr1037_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334386865 NA 1.43E-63 mr1065_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334386865 NA 1.23E-53 mr1458_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334386865 NA 1.84E-21 mr1627_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334386865 NA 5.20E-74 mr1798_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334386865 NA 5.74E-29 mr1825_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251