Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0334370940:

Variant ID: vg0334370940 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 34370940
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AGGGAAATGCGTGTACAGTCTCATCTTTTTTTTAAAAAAAATATAAATACATATGTCAGGGTTATGGATACCACCTACCTAATAGTAGTTAACTAAATCT[C/T]
GGCAGGACTCACCACATACCATGTCCTATACGGAAACTGACTTCGGATATGGAGGGAGTTCCGAATAAGGAAAGACAACCAGAGTTCTACATGAAAACGA

Reverse complement sequence

TCGTTTTCATGTAGAACTCTGGTTGTCTTTCCTTATTCGGAACTCCCTCCATATCCGAAGTCAGTTTCCGTATAGGACATGGTATGTGGTGAGTCCTGCC[G/A]
AGATTTAGTTAACTACTATTAGGTAGGTGGTATCCATAACCCTGACATATGTATTTATATTTTTTTTAAAAAAAAGATGAGACTGTACACGCATTTCCCT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	94.70%	5.30%	0.00%	0.00%	NA
All Indica	2759	99.10%	0.90%	0.00%	0.00%	NA
All Japonica	1512	98.80%	1.20%	0.00%	0.00%	NA
Aus	269	24.90%	75.10%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	100.00%	0.00%	0.00%	0.00%	NA
Indica III	913	99.20%	0.80%	0.00%	0.00%	NA
Indica Intermediate	786	97.70%	2.30%	0.00%	0.00%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	96.40%	3.60%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	96.90%	3.10%	0.00%	0.00%	NA
Intermediate	90	96.70%	3.30%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0334370940	C -> T	LOC_Os03g60449.1	upstream_gene_variant ; 766.0bp to feature; MODIFIER	silent_mutation	Average:42.858; most accessible tissue: Minghui63 root, score: 89.844	N	N	N	N
vg0334370940	C -> T	LOC_Os03g60440.1	downstream_gene_variant ; 3703.0bp to feature; MODIFIER	silent_mutation	Average:42.858; most accessible tissue: Minghui63 root, score: 89.844	N	N	N	N
vg0334370940	C -> T	LOC_Os03g60440-LOC_Os03g60449	intergenic_region ; MODIFIER	silent_mutation	Average:42.858; most accessible tissue: Minghui63 root, score: 89.844	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0334370940	NA	2.81E-15	mr1158	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334370940	NA	5.71E-14	mr1166	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334370940	NA	3.59E-06	mr1230	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334370940	NA	3.05E-20	mr1244	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334370940	1.67E-07	NA	mr1249	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334370940	4.21E-06	NA	mr1263	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334370940	NA	5.83E-07	mr1328	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334370940	NA	1.86E-06	mr1420	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334370940	NA	4.12E-06	mr1427	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334370940	NA	6.79E-08	mr1446	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334370940	4.21E-06	NA	mr1451	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334370940	NA	1.63E-18	mr1515	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334370940	NA	1.21E-06	mr1556	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334370940	NA	4.08E-25	mr1586	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334370940	NA	4.88E-06	mr1634	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334370940	NA	3.77E-07	mr1706	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334370940	NA	4.00E-10	mr1927	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334370940	NA	1.16E-07	mr1989	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334370940	NA	7.16E-20	mr1095_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334370940	1.29E-07	NA	mr1134_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334370940	1.28E-09	NA	mr1151_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334370940	NA	9.14E-09	mr1166_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334370940	5.19E-10	NA	mr1248_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334370940	1.03E-07	NA	mr1263_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334370940	NA	4.21E-25	mr1305_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334370940	NA	1.07E-13	mr1409_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334370940	NA	2.54E-10	mr1649_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334370940	NA	1.84E-06	mr1815_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251