\
| Variant ID: vg0334366587 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 34366587 |
| Reference Allele: C | Alternative Allele: T,G |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, T: 0.00, others allele: 0.00, population size: 245. )
TTCACAGTATGTTGAATGAATATTGCAATGTTTCACCGCTCGGAAAAAATGTTTCAACAAAAATTGTTTCTCGATGTTTCATCTTTCATTGAATGTTTCA[C/T,G]
CGCTCGAAAAAAAATGTTTCACCACTTTATCGAAGATGTTTCAATCGAATGCAACACTCGATAATGTTGTCTGCAACAAAAAAAACCAATATATGCAACA
TGTTGCATATATTGGTTTTTTTTGTTGCAGACAACATTATCGAGTGTTGCATTCGATTGAAACATCTTCGATAAAGTGGTGAAACATTTTTTTTCGAGCG[G/A,C]
TGAAACATTCAATGAAAGATGAAACATCGAGAAACAATTTTTGTTGAAACATTTTTTCCGAGCGGTGAAACATTGCAATATTCATTCAACATACTGTGAA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 94.20% | 5.80% | 0.00% | 0.00% | NA |
| All Indica | 2759 | 98.40% | 1.60% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 98.80% | 1.20% | 0.00% | 0.00% | NA |
| Aus | 269 | 24.50% | 75.50% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 97.20% | 2.80% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 97.60% | 2.40% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 96.40% | 3.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 96.90% | 3.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 96.70% | 3.30% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0334366587 | C -> T | LOC_Os03g60440.1 | upstream_gene_variant ; 252.0bp to feature; MODIFIER | silent_mutation | Average:37.556; most accessible tissue: Zhenshan97 panicle, score: 63.607 | N | N | N | N |
| vg0334366587 | C -> T | LOC_Os03g60430.2 | downstream_gene_variant ; 4253.0bp to feature; MODIFIER | silent_mutation | Average:37.556; most accessible tissue: Zhenshan97 panicle, score: 63.607 | N | N | N | N |
| vg0334366587 | C -> T | LOC_Os03g60430.1 | downstream_gene_variant ; 4253.0bp to feature; MODIFIER | silent_mutation | Average:37.556; most accessible tissue: Zhenshan97 panicle, score: 63.607 | N | N | N | N |
| vg0334366587 | C -> T | LOC_Os03g60430-LOC_Os03g60440 | intergenic_region ; MODIFIER | silent_mutation | Average:37.556; most accessible tissue: Zhenshan97 panicle, score: 63.607 | N | N | N | N |
| vg0334366587 | C -> G | LOC_Os03g60440.1 | upstream_gene_variant ; 252.0bp to feature; MODIFIER | N | Average:37.556; most accessible tissue: Zhenshan97 panicle, score: 63.607 | N | N | N | N |
| vg0334366587 | C -> G | LOC_Os03g60430.2 | downstream_gene_variant ; 4253.0bp to feature; MODIFIER | N | Average:37.556; most accessible tissue: Zhenshan97 panicle, score: 63.607 | N | N | N | N |
| vg0334366587 | C -> G | LOC_Os03g60430.1 | downstream_gene_variant ; 4253.0bp to feature; MODIFIER | N | Average:37.556; most accessible tissue: Zhenshan97 panicle, score: 63.607 | N | N | N | N |
| vg0334366587 | C -> G | LOC_Os03g60430-LOC_Os03g60440 | intergenic_region ; MODIFIER | N | Average:37.556; most accessible tissue: Zhenshan97 panicle, score: 63.607 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0334366587 | 2.20E-07 | NA | mr1151 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0334366587 | NA | 5.55E-07 | mr1157 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0334366587 | NA | 1.54E-24 | mr1244 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0334366587 | 5.63E-06 | NA | mr1248 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0334366587 | 1.29E-07 | NA | mr1249 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0334366587 | NA | 2.72E-08 | mr1446 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0334366587 | NA | 3.86E-07 | mr1706 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0334366587 | NA | 9.89E-10 | mr1927 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0334366587 | NA | 4.37E-08 | mr1989 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0334366587 | NA | 6.44E-21 | mr1095_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0334366587 | NA | 3.28E-29 | mr1098_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0334366587 | 6.75E-06 | NA | mr1151_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0334366587 | 2.38E-08 | NA | mr1248_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0334366587 | 4.02E-06 | NA | mr1263_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |