\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0334366587:

Variant ID: vg0334366587 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 34366587
Reference Allele: CAlternative Allele: T,G
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, T: 0.00, others allele: 0.00, population size: 245. )

Flanking Sequence (100 bp) in Reference Genome:


TTCACAGTATGTTGAATGAATATTGCAATGTTTCACCGCTCGGAAAAAATGTTTCAACAAAAATTGTTTCTCGATGTTTCATCTTTCATTGAATGTTTCA[C/T,G]
CGCTCGAAAAAAAATGTTTCACCACTTTATCGAAGATGTTTCAATCGAATGCAACACTCGATAATGTTGTCTGCAACAAAAAAAACCAATATATGCAACA

Reverse complement sequence

TGTTGCATATATTGGTTTTTTTTGTTGCAGACAACATTATCGAGTGTTGCATTCGATTGAAACATCTTCGATAAAGTGGTGAAACATTTTTTTTCGAGCG[G/A,C]
TGAAACATTCAATGAAAGATGAAACATCGAGAAACAATTTTTGTTGAAACATTTTTTCCGAGCGGTGAAACATTGCAATATTCATTCAACATACTGTGAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 94.20% 5.80% 0.00% 0.00% NA
All Indica  2759 98.40% 1.60% 0.00% 0.00% NA
All Japonica  1512 98.80% 1.20% 0.00% 0.00% NA
Aus  269 24.50% 75.50% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 97.20% 2.80% 0.00% 0.00% NA
Indica Intermediate  786 97.60% 2.40% 0.00% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 96.40% 3.60% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 96.90% 3.10% 0.00% 0.00% NA
Intermediate  90 96.70% 3.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0334366587 C -> T LOC_Os03g60440.1 upstream_gene_variant ; 252.0bp to feature; MODIFIER silent_mutation Average:37.556; most accessible tissue: Zhenshan97 panicle, score: 63.607 N N N N
vg0334366587 C -> T LOC_Os03g60430.2 downstream_gene_variant ; 4253.0bp to feature; MODIFIER silent_mutation Average:37.556; most accessible tissue: Zhenshan97 panicle, score: 63.607 N N N N
vg0334366587 C -> T LOC_Os03g60430.1 downstream_gene_variant ; 4253.0bp to feature; MODIFIER silent_mutation Average:37.556; most accessible tissue: Zhenshan97 panicle, score: 63.607 N N N N
vg0334366587 C -> T LOC_Os03g60430-LOC_Os03g60440 intergenic_region ; MODIFIER silent_mutation Average:37.556; most accessible tissue: Zhenshan97 panicle, score: 63.607 N N N N
vg0334366587 C -> G LOC_Os03g60440.1 upstream_gene_variant ; 252.0bp to feature; MODIFIER N Average:37.556; most accessible tissue: Zhenshan97 panicle, score: 63.607 N N N N
vg0334366587 C -> G LOC_Os03g60430.2 downstream_gene_variant ; 4253.0bp to feature; MODIFIER N Average:37.556; most accessible tissue: Zhenshan97 panicle, score: 63.607 N N N N
vg0334366587 C -> G LOC_Os03g60430.1 downstream_gene_variant ; 4253.0bp to feature; MODIFIER N Average:37.556; most accessible tissue: Zhenshan97 panicle, score: 63.607 N N N N
vg0334366587 C -> G LOC_Os03g60430-LOC_Os03g60440 intergenic_region ; MODIFIER N Average:37.556; most accessible tissue: Zhenshan97 panicle, score: 63.607 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0334366587 2.20E-07 NA mr1151 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334366587 NA 5.55E-07 mr1157 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334366587 NA 1.54E-24 mr1244 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334366587 5.63E-06 NA mr1248 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334366587 1.29E-07 NA mr1249 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334366587 NA 2.72E-08 mr1446 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334366587 NA 3.86E-07 mr1706 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334366587 NA 9.89E-10 mr1927 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334366587 NA 4.37E-08 mr1989 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334366587 NA 6.44E-21 mr1095_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334366587 NA 3.28E-29 mr1098_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334366587 6.75E-06 NA mr1151_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334366587 2.38E-08 NA mr1248_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0334366587 4.02E-06 NA mr1263_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251